MD07G1101300.v1.1

K homology RNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0014821
Physical Location & Seq
Forward (+)
11231826 .. 11234291
2466 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1101300.v1.1.491

Sequence Viewer

Length: 321 bp
ATGGTGATATCGGAAACGCTAGTTGGTGGGTTGATTGGTAGAAACGGCTCCAACATTTCAAGGATCAGAAATGAGTCTGGAGCAATGGTCAAGGTTTATGGAGGGAAAGGTGAGCAAAAGCATAGGCAAGTACAGTTTTGTGGTAGTGCTCATCAGGTCTACTGGCAAAGCAGAGGGTTGATGAGTACGTATATTCTCAGCTGGTACGACAACCCCTCTCTCAACAGCCGGCGTAAGTTTCCTCCTATAATGCTTTTTCCCACTATCTCCTTGGTTGTGTACTGGCAATCGGTCATTTGTTATGCACAAGTTGCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KH_1

Protein Analysis

107

Amino Acids

12.01

Weight (kDa)

9.86

Isoelectric Point (pI)

46.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
KH_1 PF00013 1 - 53 4e-10 KH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 159
AclWI GGATC 1 cut(s) 71
AfaI GTAC 4 cut(s) 132, 187, 206, 281
AgsI TTSAA 1 cut(s) 60
AjuI GAANNNNNNNTTGG 1 cut(s) 38
AluBI AGCT 1 cut(s) 201
AluI AGCT 1 cut(s) 201
Alw21I GWGCWC 1 cut(s) 151
AlwI GGATC 1 cut(s) 71
AsuHPI GGTGA 2 cut(s) 16, 122
Bbv12I GWGCWC 1 cut(s) 151
BceAI ACGGC 1 cut(s) 61
BfaI CTAG 1 cut(s) 20
BmiI GGNNCC 1 cut(s) 49
BpmI CTGGAG 1 cut(s) 99
BsaAI YACGTR 1 cut(s) 189
BsaJI CCNNGG 1 cut(s) 270
BsaXI ACNNNNNCTCC 2 cut(s) 72, 102
Bse118I RCCGGY 1 cut(s) 228
Bse1I ACTGG 2 cut(s) 167, 287
Bse3DI GCAATG 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 270
BseMI GCAATG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 211
BseNI ACTGG 2 cut(s) 167, 287
BsiHKAI GWGCWC 1 cut(s) 151
BsiSI CCGG 1 cut(s) 229
Bsp1286I GDGCHC 1 cut(s) 151
Bsp143I GATC 1 cut(s) 63
BspCNI CTCAG 1 cut(s) 210
BspLI GGNNCC 1 cut(s) 49
BspPI GGATC 1 cut(s) 71
BsrDI GCAATG 1 cut(s) 90
BsrFI RCCGGY 1 cut(s) 228
BsrI ACTGG 2 cut(s) 167, 287
BssAI RCCGGY 1 cut(s) 228
BssECI CCNNGG 1 cut(s) 270
BssMI GATC 1 cut(s) 63
BssT1I CCWWGG 1 cut(s) 270
Bst4CI ACNGT 1 cut(s) 135
BstAPI GCANNNNNTGC 1 cut(s) 311
BstBAI YACGTR 1 cut(s) 189
BstC8I GCNNGC 1 cut(s) 230
BstDEI CTNAG 1 cut(s) 197
BstKTI GATC 1 cut(s) 66
BstMBI GATC 1 cut(s) 63
BstMWI GCNNNNNNNGC 1 cut(s) 311
BstSNI TACGTA 1 cut(s) 189
Cac8I GCNNGC 1 cut(s) 230
Cfr10I RCCGGY 1 cut(s) 228
Csp6I GTAC 4 cut(s) 131, 186, 205, 280
CviJI RGCY 3 cut(s) 48, 201, 228
CviKI_1 RGCY 3 cut(s) 48, 201, 228
CviQI GTAC 4 cut(s) 131, 186, 205, 280
DdeI CTNAG 1 cut(s) 197
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
Eco105I TACGTA 1 cut(s) 189
Eco130I CCWWGG 1 cut(s) 270
Eco32I GATATC 1 cut(s) 9
EcoRV GATATC 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 270
ErhI CCWWGG 1 cut(s) 270
FaiI YATR 5 cut(s) 99, 123, 192, 248, 303
FblI GTMKAC 1 cut(s) 159
FspBI CTAG 1 cut(s) 20
GsuI CTGGAG 1 cut(s) 99
HapII CCGG 1 cut(s) 229
HinfI GANTC 1 cut(s) 74
HpaII CCGG 1 cut(s) 229
HphI GGTGA 2 cut(s) 16, 122
Hpy166II GTNNAC 2 cut(s) 160, 280
Hpy188I TCNGA 2 cut(s) 13, 68
Hpy188III TCNNGA 1 cut(s) 78
Hpy8I GTNNAC 2 cut(s) 160, 280
HpyCH4III ACNGT 1 cut(s) 135
HpyCH4IV ACGT 1 cut(s) 188
HpyCH4V TGCA 1 cut(s) 305
HpyF10VI GCNNNNNNNGC 1 cut(s) 311
HpyF3I CTNAG 1 cut(s) 197
HpySE526I ACGT 1 cut(s) 188
KroI GCCGGC 1 cut(s) 228
KroNI GCCGGC 1 cut(s) 230
Kzo9I GATC 1 cut(s) 63
LmnI GCTCC 2 cut(s) 53, 80
LpnPI CCDG 6 cut(s) 63, 140, 148, 187, 242, 268
MaeI CTAG 1 cut(s) 20
MaeII ACGT 1 cut(s) 188
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MhlI GDGCHC 1 cut(s) 151
MlyI GAGTC 1 cut(s) 83
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 4 cut(s) 95, 167, 226, 252
MroNI GCCGGC 1 cut(s) 228
MspA1I CMGCKG 1 cut(s) 201
MspI CCGG 1 cut(s) 229
MwoI GCNNNNNNNGC 1 cut(s) 311
NaeI GCCGGC 1 cut(s) 230
NdeII GATC 1 cut(s) 63
NgoMIV GCCGGC 1 cut(s) 228
NlaIV GGNNCC 1 cut(s) 49
PdiI GCCGGC 1 cut(s) 230
PleI GAGTC 1 cut(s) 82
PpsI GAGTC 1 cut(s) 82
Ppu21I YACGTR 1 cut(s) 189
PspN4I GGNNCC 1 cut(s) 49
PvuII CAGCTG 1 cut(s) 201
RsaI GTAC 4 cut(s) 132, 187, 206, 281
RsaNI GTAC 4 cut(s) 131, 186, 205, 280
Sau3AI GATC 1 cut(s) 63
SchI GAGTC 1 cut(s) 83
SduI GDGCHC 1 cut(s) 151
SetI ASST 5 cut(s) 96, 112, 159, 191, 203
SnaBI TACGTA 1 cut(s) 189
SspMI CTAG 1 cut(s) 20
StyI CCWWGG 1 cut(s) 270
TaaI ACNGT 1 cut(s) 135
TaiI ACGT 1 cut(s) 191
TaqII GACCGA 1 cut(s) 280
TatI WGTACW 2 cut(s) 130, 279
XcmI CCANNNNNNNNNTGG 1 cut(s) 268
XmiI GTMKAC 1 cut(s) 159
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.