Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr07

Orthogroup ID

OG0013724

Physical Location & Seq

Genomic Coordinates Forward (+)

23941564 .. 23952810

Gene Structure 11247 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD07G1164600.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 129 bp

ATGTGCATGAATGGGGTGGTACTCGGAGAATTTTGTCAAGGGCCAATGGGACAAGGAGGATTGCATTTCAGATTGGCAGAAATACAATGCCTCCCATCTGTGTGTATAATGTCATCAAATTCTAGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

43

Amino Acids

4.5

Weight (kDa)

6.5

Isoelectric Point (pI)

45.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013724)

Species	Orthologous Gene IDs
malus_domestica	MD00G1023700.v1.1 MD02G1173800.v1.1 MD02G1253200.v1.1 MD02G1254000.v1.1 MD03G1270800.v1.1 MD07G1164600.v1.1 MD07G1201300.v1.1 MD09G1237100.v1.1 MD10G1011600.v1.1 MD10G1322600.v1.1 MD12G1253700.v1.1 MD16G1114600.v1.1
pyrus_communis	pycom01g20530 pycom05g23680 pycom05g24210 pycom05g24250 pycom10g04750 pycom17g24110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	29, 118
AfaI	GTAC	1 cut(s)	21
AoxI	GGCC	1 cut(s)	41
ApoI	RAATTY	2 cut(s)	29, 118
AspS9I	GGNCC	1 cut(s)	41
BccI	CCATC	1 cut(s)	103
BfaI	CTAG	1 cut(s)	123
BmgT120I	GGNCC	1 cut(s)	41
BsaXI	ACNNNNNCTCC	2 cut(s)	75, 105
BshFI	GGCC	1 cut(s)	43
BslFI	GGGAC	1 cut(s)	63
BsmFI	GGGAC	1 cut(s)	63
BsnI	GGCC	1 cut(s)	43
BspANI	GGCC	1 cut(s)	43
BsuRI	GGCC	1 cut(s)	43
Cfr13I	GGNCC	1 cut(s)	41
Csp6I	GTAC	1 cut(s)	20
CviAII	CATG	1 cut(s)	7
CviJI	RGCY	1 cut(s)	43
CviKI_1	RGCY	1 cut(s)	43
CviQI	GTAC	1 cut(s)	20
FaeI	CATG	1 cut(s)	10
FaiI	YATR	2 cut(s)	8, 107
FaqI	GGGAC	1 cut(s)	63
FatI	CATG	1 cut(s)	6
FspBI	CTAG	1 cut(s)	123
HaeIII	GGCC	1 cut(s)	43
Hin1II	CATG	1 cut(s)	10
Hpy188I	TCNGA	2 cut(s)	26, 71
Hpy188III	TCNNGA	1 cut(s)	123
HpyCH4V	TGCA	2 cut(s)	6, 64
Hsp92II	CATG	1 cut(s)	10
MaeI	CTAG	1 cut(s)	123
MluCI	AATT	2 cut(s)	29, 118
MnlI	CCTC	2 cut(s)	50, 101
MslI	CAYNNNNRTG	1 cut(s)	100
NlaIII	CATG	1 cut(s)	10
PspPI	GGNCC	1 cut(s)	41
RsaI	GTAC	1 cut(s)	21
RsaNI	GTAC	1 cut(s)	20
RseI	CAYNNNNRTG	1 cut(s)	100
Sau96I	GGNCC	1 cut(s)	41
SgeI	CNNG	4 cut(s)	19, 35, 50, 65
SmiMI	CAYNNNNRTG	1 cut(s)	100
Sse9I	AATT	2 cut(s)	29, 118
SspMI	CTAG	1 cut(s)	123
TasI	AATT	2 cut(s)	29, 118
TspDTI	ATGAA	1 cut(s)	23
XapI	RAATTY	2 cut(s)	29, 118
XbaI	TCTAGA	1 cut(s)	122
XspI	CTAG	1 cut(s)	123

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.