MD09G1237100.v1.1

DNA recombination

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0013724
Physical Location & Seq
Reverse (-)
29972985 .. 29973778
794 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1237100.v1.1.491

Sequence Viewer

Length: 333 bp
ATGGAAGATGAAGGTCCAACTCCACTTGACCAATTGGTGGCATATAAATGGTTGTCAAAATTAAAGTGTGTGTTTGTAGAATATGGAAACCAAAGTATCCAGGCATGGGCGATAAATATACAACCTTACATTGTATATTGGTTGATGAAAAGAAATAAAGAGGCTAAGATTACACTATGGTCAGATGTTGCGCATAGCTTCTCTGCTCTTTCATCAGAACAGCTACCCAAGCCAATAATTGTTATTTTTACAAGCTTTAGAGTTAAACTCTTTGCAGGTATTTGCTTTAATAAAAAAATTTATTATTTTCTATTTTCTTTGAAATCTGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03030 ko03420 ko03430 ko03440 ko03460 map03030 map03420 map03430 map03440 map03460
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.83

Weight (kDa)

9.28

Isoelectric Point (pI)

27.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 192
Acc36I ACCTGC 1 cut(s) 266
AccB7I CCANNNNNTGG 1 cut(s) 37
AcsI RAATTY 1 cut(s) 297
AfiI CCNNNNNNNGG 2 cut(s) 37, 106
AgsI TTSAA 1 cut(s) 322
AjnI CCWGG 1 cut(s) 99
AluBI AGCT 3 cut(s) 198, 223, 255
AluI AGCT 3 cut(s) 198, 223, 255
ApoI RAATTY 1 cut(s) 297
AspLEI GCGC 1 cut(s) 193
AspS9I GGNCC 1 cut(s) 14
AvaII GGWCC 1 cut(s) 14
BaeI ACNNNNGTAYC 2 cut(s) 79, 112
BciT130I CCWGG 1 cut(s) 101
BciVI GTATCC 1 cut(s) 107
BfuAI ACCTGC 1 cut(s) 266
BfuI GTATCC 1 cut(s) 107
Bme1390I CCNGG 1 cut(s) 101
Bme18I GGWCC 1 cut(s) 14
BmgT120I GGNCC 1 cut(s) 14
BmrFI CCNGG 1 cut(s) 101
BplI GAGNNNNNCTC 2 cut(s) 252, 284
Bsc4I CCNNNNNNNGG 2 cut(s) 37, 106
BseBI CCWGG 1 cut(s) 101
BseLI CCNNNNNNNGG 2 cut(s) 37, 106
BslI CCNNNNNNNGG 2 cut(s) 37, 106
BspMI ACCTGC 1 cut(s) 266
Bst2UI CCWGG 1 cut(s) 101
BstDEI CTNAG 1 cut(s) 165
BstHHI GCGC 1 cut(s) 193
BstMWI GCNNNNNNNGC 1 cut(s) 229
BstNI CCWGG 1 cut(s) 101
BstSCI CCNGG 1 cut(s) 99
BsuI GTATCC 1 cut(s) 107
BveI ACCTGC 1 cut(s) 266
CfoI GCGC 1 cut(s) 193
Cfr13I GGNCC 1 cut(s) 14
CviAII CATG 1 cut(s) 105
CviJI RGCY 5 cut(s) 164, 198, 223, 232, 255
CviKI_1 RGCY 5 cut(s) 164, 198, 223, 232, 255
DdeI CTNAG 1 cut(s) 165
Eco47I GGWCC 1 cut(s) 14
EcoRII CCWGG 1 cut(s) 99
FaeI CATG 1 cut(s) 108
FaiI YATR 8 cut(s) 43, 45, 84, 106, 119, 136, 178, 195
FatI CATG 1 cut(s) 104
FspI TGCGCA 1 cut(s) 192
GlaI GCGC 1 cut(s) 192
HhaI GCGC 1 cut(s) 193
Hin1II CATG 1 cut(s) 108
Hin6I GCGC 1 cut(s) 191
HinP1I GCGC 1 cut(s) 191
HindIII AAGCTT 1 cut(s) 253
Hpy188I TCNGA 2 cut(s) 184, 217
HpyAV CCTTC 1 cut(s) 5
HpyCH4V TGCA 1 cut(s) 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 229
HpyF3I CTNAG 1 cut(s) 165
Hsp92II CATG 1 cut(s) 108
HspAI GCGC 1 cut(s) 191
LpnPI CCDG 3 cut(s) 86, 113, 261
MboII GAAGA 1 cut(s) 17
MfeI CAATTG 1 cut(s) 32
MluCI AATT 4 cut(s) 32, 59, 237, 297
MmeI TCCRAC 1 cut(s) 41
MnlI CCTC 1 cut(s) 154
MseI TTAA 3 cut(s) 62, 264, 288
MslI CAYNNNNRTG 1 cut(s) 46
MspR9I CCNGG 1 cut(s) 101
MunI CAATTG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 229
NlaIII CATG 1 cut(s) 108
NsbI TGCGCA 1 cut(s) 192
PflMI CCANNNNNTGG 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 99
PspGI CCWGG 1 cut(s) 99
PspPI GGNCC 1 cut(s) 14
RseI CAYNNNNRTG 1 cut(s) 46
SaqAI TTAA 3 cut(s) 62, 264, 288
Sau96I GGNCC 1 cut(s) 14
ScrFI CCNGG 1 cut(s) 101
SetI ASST 6 cut(s) 16, 127, 200, 225, 257, 280
SgeI CNNG 7 cut(s) 38, 112, 113, 117, 241, 264, 288
SinI GGWCC 1 cut(s) 14
SmiMI CAYNNNNRTG 1 cut(s) 46
Sse9I AATT 4 cut(s) 32, 59, 237, 297
StyD4I CCNGG 1 cut(s) 99
TasI AATT 4 cut(s) 32, 59, 237, 297
Tru1I TTAA 3 cut(s) 62, 264, 288
Tru9I TTAA 3 cut(s) 62, 264, 288
TspDTI ATGAA 3 cut(s) 24, 161, 201
Van91I CCANNNNNTGG 1 cut(s) 37
VpaK11BI GGWCC 1 cut(s) 14
XapI RAATTY 1 cut(s) 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.