Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr10

Orthogroup ID

OG0013724

Physical Location & Seq

Genomic Coordinates Reverse (-)

40398605 .. 40400603

Gene Structure 1999 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD10G1322600.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 165 bp

ATGGATCAAGTTTGTCAAGGGCCGATGGGACAAGGAGGATTGCATTTCATATTGGCAGAAATACAAGGCCTCCCTCTCTGTATAATGCCATCAAATTCTCCACGAGGTGCATCCAGACATCAGTTTGGTAAAGGTGAAGATTTGCCTAATCATATGAGAAAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

55

Amino Acids

5.89

Weight (kDa)

7.88

Isoelectric Point (pI)

38.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013724)

Species	Orthologous Gene IDs
malus_domestica	MD00G1023700.v1.1 MD02G1173800.v1.1 MD02G1253200.v1.1 MD02G1254000.v1.1 MD03G1270800.v1.1 MD07G1164600.v1.1 MD07G1201300.v1.1 MD09G1237100.v1.1 MD10G1011600.v1.1 MD10G1322600.v1.1 MD12G1253700.v1.1 MD16G1114600.v1.1
pyrus_communis	pycom01g20530 pycom05g23680 pycom05g24210 pycom05g24250 pycom10g04750 pycom17g24110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	12
AcsI	RAATTY	1 cut(s)	94
AdeI	CACNNNGTG	1 cut(s)	107
AlwI	GGATC	1 cut(s)	12
AoxI	GGCC	2 cut(s)	20, 67
ApoI	RAATTY	1 cut(s)	94
AspS9I	GGNCC	1 cut(s)	20
AsuHPI	GGTGA	1 cut(s)	146
BauI	CACGAG	1 cut(s)	102
BccI	CCATC	2 cut(s)	19, 97
BmgT120I	GGNCC	1 cut(s)	20
BmsI	GCATC	1 cut(s)	119
BsaXI	ACNNNNNCTCC	2 cut(s)	54, 84
BseGI	GGATG	1 cut(s)	110
BshFI	GGCC	2 cut(s)	22, 69
BslFI	GGGAC	1 cut(s)	42
BsmFI	GGGAC	1 cut(s)	42
BsnI	GGCC	2 cut(s)	22, 69
Bsp143I	GATC	1 cut(s)	4
BspANI	GGCC	2 cut(s)	22, 69
BspPI	GGATC	1 cut(s)	12
BssMI	GATC	1 cut(s)	4
BssSI	CACGAG	1 cut(s)	102
Bst2BI	CACGAG	1 cut(s)	102
BstF5I	GGATG	1 cut(s)	110
BstKTI	GATC	1 cut(s)	7
BstMBI	GATC	1 cut(s)	4
BsuRI	GGCC	2 cut(s)	22, 69
BtsCI	GGATG	1 cut(s)	110
Cfr13I	GGNCC	1 cut(s)	20
CviJI	RGCY	2 cut(s)	22, 69
CviKI_1	RGCY	2 cut(s)	22, 69
DpnI	GATC	1 cut(s)	6
DpnII	GATC	1 cut(s)	4
DraIII	CACNNNGTG	1 cut(s)	107
Eco147I	AGGCCT	1 cut(s)	69
FaiI	YATR	4 cut(s)	50, 83, 153, 155
FaqI	GGGAC	1 cut(s)	42
FauNDI	CATATG	1 cut(s)	153
FokI	GGATG	1 cut(s)	97
HaeIII	GGCC	2 cut(s)	22, 69
HphI	GGTGA	1 cut(s)	146
Hpy188III	TCNNGA	1 cut(s)	114
HpyCH4V	TGCA	2 cut(s)	43, 110
Kzo9I	GATC	1 cut(s)	4
LpnPI	CCDG	1 cut(s)	127
LweI	GCATC	1 cut(s)	119
MalI	GATC	1 cut(s)	6
MboI	GATC	1 cut(s)	4
MboII	GAAGA	1 cut(s)	149
MluCI	AATT	1 cut(s)	94
MnlI	CCTC	4 cut(s)	29, 80, 84, 98
NdeI	CATATG	1 cut(s)	153
NdeII	GATC	1 cut(s)	4
PceI	AGGCCT	1 cut(s)	69
PspPI	GGNCC	1 cut(s)	20
Sau3AI	GATC	1 cut(s)	4
Sau96I	GGNCC	1 cut(s)	20
SetI	ASST	2 cut(s)	109, 136
SfaNI	GCATC	1 cut(s)	119
SgeI	CNNG	7 cut(s)	20, 29, 44, 77, 114, 116, 126
Sse9I	AATT	1 cut(s)	94
SseBI	AGGCCT	1 cut(s)	69
StuI	AGGCCT	1 cut(s)	69
TasI	AATT	1 cut(s)	94
TspDTI	ATGAA	1 cut(s)	37
XapI	RAATTY	1 cut(s)	94

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.