Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr07

Orthogroup ID

OG0005643

Physical Location & Seq

Genomic Coordinates Forward (+)

31979473 .. 31982028

Gene Structure 2556 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD07G1251800.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

ATGTTATGTAGAATCTGGTGCAACAGCTGCAGGATTTGCAGGGCCAGGCTTAGCAGAAGTTTTACTCGTTTCTTTATCGCAACATCAAAGAAGCTGAATACGTTTATTCGACTTAACCTTTCAGGAGGAGCTGCTGCTCTATTTGGACTATGGAGCTTGTCTAGGTCCTTAAATTCATGTGTTAGCCATTTTCTTTCTCAGGATGGAAGTCGTATGCAGGCGGAGTTAGCAACTATAGAATCCTGGGTATGTCCAGCATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

87

Amino Acids

9.67

Weight (kDa)

10.2

Isoelectric Point (pI)

49.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005643)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G05430
fragaria_vesca	FvH4_4g16290 FvH4_4g16290 FvH4_4g16290
malus_domestica	MD07G1251800.v1.1 MD13G1194600.v1.1 MD13G1194700.v1.1 MD13G1194800.v1.1 MD16G1195500.v1.1
prunus_persica	Prupe.1G015500_v2.0.a1 Prupe.1G015500_v2.0.a1 Prupe.1G015500_v2.0.a1 Prupe.1G015500_v2.0.a1 Prupe.1G015500_v2.0.a1 Prupe.1G015500_v2.0.a1
pyrus_communis	pycom13g16700 pycom16g16470
rosa_chinensis	RchiOBHm_Chr4g0415951
rosa_laevigata	RLG00000008026
rosa_multiflora	Rmu_sc0005415.1_g000004 Rmu_sc0005922.1_g000001
rosa_roxburghii	Rroxscaffold_5G00359830
rosa_rugosa	Rorug04G0137200
rosa_samantha	Rh4AG199600 Rh4BG197100 Rh4CG210600 Rh4DG197400
rosa_wichuraiana	Rw4G016920

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	221
AcsI	RAATTY	1 cut(s)	172
AjnI	CCWGG	2 cut(s)	44, 242
AluBI	AGCT	4 cut(s)	27, 94, 131, 156
AluI	AGCT	4 cut(s)	27, 94, 131, 156
AoxI	GGCC	1 cut(s)	42
ApeKI	GCWGC	3 cut(s)	27, 131, 134
ApoI	RAATTY	1 cut(s)	172
AspS9I	GGNCC	2 cut(s)	42, 165
AvaII	GGWCC	1 cut(s)	165
BbvI	GCAGC	3 cut(s)	14, 118, 121
BccI	CCATC	1 cut(s)	197
BciT130I	CCWGG	2 cut(s)	46, 244
BfaI	CTAG	1 cut(s)	162
BfmI	CTRYAG	2 cut(s)	28, 234
BisI	GCNGC	3 cut(s)	28, 132, 135
BlpI	GCTNAGC	1 cut(s)	50
BlsI	GCNGC	3 cut(s)	29, 133, 136
Bme1390I	CCNGG	2 cut(s)	46, 244
Bme18I	GGWCC	1 cut(s)	165
BmgT120I	GGNCC	2 cut(s)	42, 165
BmrFI	CCNGG	2 cut(s)	46, 244
Bpu1102I	GCTNAGC	1 cut(s)	50
BsaJI	CCNNGG	1 cut(s)	243
BseBI	CCWGG	2 cut(s)	46, 244
BseDI	CCNNGG	1 cut(s)	243
BseGI	GGATG	1 cut(s)	208
BseMII	CTCAG	1 cut(s)	212
BseRI	GAGGAG	1 cut(s)	141
BseXI	GCAGC	3 cut(s)	14, 118, 121
BshFI	GGCC	1 cut(s)	44
BsnI	GGCC	1 cut(s)	44
Bsp1720I	GCTNAGC	1 cut(s)	50
BspACI	CCGC	1 cut(s)	221
BspANI	GGCC	1 cut(s)	44
BspCNI	CTCAG	1 cut(s)	211
BspMAI	CTGCAG	1 cut(s)	32
BssECI	CCNNGG	1 cut(s)	243
Bst2UI	CCWGG	2 cut(s)	46, 244
BstAPI	GCANNNNNTGC	2 cut(s)	27, 36
BstC8I	GCNNGC	1 cut(s)	219
BstDEI	CTNAG	2 cut(s)	50, 198
BstF5I	GGATG	1 cut(s)	208
BstMWI	GCNNNNNNNGC	3 cut(s)	27, 36, 227
BstNI	CCWGG	2 cut(s)	46, 244
BstSCI	CCNGG	2 cut(s)	44, 242
BstSFI	CTRYAG	2 cut(s)	28, 234
BstV1I	GCAGC	3 cut(s)	14, 118, 121
BsuRI	GGCC	1 cut(s)	44
BtsCI	GGATG	1 cut(s)	208
Cac8I	GCNNGC	1 cut(s)	219
Cfr13I	GGNCC	2 cut(s)	42, 165
CviAII	CATG	1 cut(s)	177
CviJI	RGCY	7 cut(s)	27, 44, 49, 94, 131, 156, 186
CviKI_1	RGCY	7 cut(s)	27, 44, 49, 94, 131, 156, 186
DdeI	CTNAG	2 cut(s)	50, 198
EciI	GGCGGA	1 cut(s)	236
Eco47I	GGWCC	1 cut(s)	165
EcoO109I	RGGNCCY	1 cut(s)	165
EcoRII	CCWGG	2 cut(s)	44, 242
FaeI	CATG	1 cut(s)	180
FaiI	YATR	7 cut(s)	7, 151, 178, 215, 236, 250, 259
FatI	CATG	1 cut(s)	176
Fnu4HI	GCNGC	3 cut(s)	28, 132, 135
FokI	GGATG	1 cut(s)	215
Fsp4HI	GCNGC	3 cut(s)	28, 132, 135
FspBI	CTAG	1 cut(s)	162
GluI	GCNGC	3 cut(s)	28, 132, 135
HaeIII	GGCC	1 cut(s)	44
Hin1II	CATG	1 cut(s)	180
HinfI	GANTC	2 cut(s)	12, 239
Hpy188III	TCNNGA	2 cut(s)	123, 200
HpyCH4IV	ACGT	1 cut(s)	101
HpyCH4V	TGCA	4 cut(s)	21, 30, 39, 217
HpyF10VI	GCNNNNNNNGC	3 cut(s)	27, 36, 227
HpyF3I	CTNAG	2 cut(s)	50, 198
HpySE526I	ACGT	1 cut(s)	101
Hsp92II	CATG	1 cut(s)	180
LmnI	GCTCC	2 cut(s)	128, 153
LpnPI	CCDG	9 cut(s)	16, 25, 31, 58, 108, 185, 203, 229, 256
Lsp1109I	GCAGC	3 cut(s)	14, 118, 121
MaeI	CTAG	1 cut(s)	162
MaeII	ACGT	1 cut(s)	101
MluCI	AATT	1 cut(s)	172
MnlI	CCTC	1 cut(s)	119
MseI	TTAA	2 cut(s)	114, 170
MspA1I	CMGCKG	1 cut(s)	27
MspR9I	CCNGG	2 cut(s)	46, 244
MvaI	CCWGG	2 cut(s)	46, 244
MwoI	GCNNNNNNNGC	3 cut(s)	27, 36, 227
NlaIII	CATG	1 cut(s)	180
PfeI	GAWTC	2 cut(s)	12, 239
PkrI	GCNGC	3 cut(s)	29, 133, 136
PpuMI	RGGWCCY	1 cut(s)	165
Psp5II	RGGWCCY	1 cut(s)	165
Psp6I	CCWGG	2 cut(s)	44, 242
PspGI	CCWGG	2 cut(s)	44, 242
PspPI	GGNCC	2 cut(s)	42, 165
PspPPI	RGGWCCY	1 cut(s)	165
PstI	CTGCAG	1 cut(s)	32
PvuII	CAGCTG	1 cut(s)	27
SaqAI	TTAA	2 cut(s)	114, 170
SatI	GCNGC	3 cut(s)	28, 132, 135
Sau96I	GGNCC	2 cut(s)	42, 165
ScrFI	CCNGG	2 cut(s)	46, 244
SetI	ASST	7 cut(s)	29, 96, 104, 120, 133, 158, 167
SfcI	CTRYAG	2 cut(s)	28, 234
SinI	GGWCC	1 cut(s)	165
Sse9I	AATT	1 cut(s)	172
SsiI	CCGC	1 cut(s)	221
SspMI	CTAG	1 cut(s)	162
StyD4I	CCNGG	2 cut(s)	44, 242
TaiI	ACGT	1 cut(s)	104
TaqI	TCGA	1 cut(s)	109
TasI	AATT	1 cut(s)	172
TfiI	GAWTC	2 cut(s)	12, 239
Tru1I	TTAA	2 cut(s)	114, 170
Tru9I	TTAA	2 cut(s)	114, 170
TseI	GCWGC	3 cut(s)	27, 131, 134
TspDTI	ATGAA	1 cut(s)	165
VpaK11BI	GGWCC	1 cut(s)	165
XapI	RAATTY	1 cut(s)	172
XspI	CTAG	1 cut(s)	162

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.