MD07G1285700.v1.1
MYB Family

Transcription factor

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
34779139 .. 34781091
1953 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1285700.v1.1.491

Sequence Viewer

Length: 300 bp
ATGGACCGATGTCGTCGGAAGCGACCCCAAATCACCATTAGTGATCAATCTGAAGAGGTTATTAGCAATGAATGGGAATTCATAAACATGACTGAACAAGAAGAAGATATCCTCTGTCGAATGTATAGGCTCGTTGGACCCAGGTGGGATTTAATAGCCGGTCGGATTCCAGGTCGAAAAGCAGAAGAACTAGAGAGGTTTTGGATCATGAAGCATTGTGATACGTTTGCTGACAAACGAAATCAGCATAAGAAAGAGGACGCTAAAATTGTTCGTCGAATGTTTAATGGATTTAAGTAG

Protein Analysis

100

Amino Acids

12.1

Weight (kDa)

8.9

Isoelectric Point (pI)

59.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 30 - 69 1.6e-07 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 212
AcsI RAATTY 1 cut(s) 77
AcuI CTGAAG 1 cut(s) 72
AjnI CCWGG 2 cut(s) 140, 169
AlwI GGATC 1 cut(s) 212
ApoI RAATTY 1 cut(s) 77
AspS9I GGNCC 2 cut(s) 4, 137
AsuHPI GGTGA 1 cut(s) 25
AvaII GGWCC 2 cut(s) 4, 137
BciT130I CCWGG 2 cut(s) 142, 171
BclI TGATCA 1 cut(s) 43
BfaI CTAG 1 cut(s) 191
Bme1390I CCNGG 2 cut(s) 142, 171
Bme18I GGWCC 2 cut(s) 4, 137
BmgT120I GGNCC 2 cut(s) 4, 137
BmiI GGNNCC 1 cut(s) 139
BmrFI CCNGG 2 cut(s) 142, 171
BoxI GACNNNNGTC 1 cut(s) 9
BsaJI CCNNGG 1 cut(s) 140
Bse118I RCCGGY 1 cut(s) 158
Bse3DI GCAATG 1 cut(s) 73
BseBI CCWGG 2 cut(s) 142, 171
BseDI CCNNGG 1 cut(s) 140
BseMI GCAATG 1 cut(s) 73
Bsh1285I CGRYCG 1 cut(s) 163
BsiEI CGRYCG 1 cut(s) 163
BsiSI CCGG 1 cut(s) 159
Bsp143I GATC 2 cut(s) 43, 204
BspHI TCATGA 1 cut(s) 207
BspLI GGNNCC 1 cut(s) 139
BspPI GGATC 1 cut(s) 212
BsrDI GCAATG 1 cut(s) 73
BsrFI RCCGGY 1 cut(s) 158
BssAI RCCGGY 1 cut(s) 158
BssECI CCNNGG 1 cut(s) 140
BssMI GATC 2 cut(s) 43, 204
Bst2UI CCWGG 2 cut(s) 142, 171
Bst6I CTCTTC 1 cut(s) 48
BstKTI GATC 2 cut(s) 46, 207
BstMBI GATC 2 cut(s) 43, 204
BstMCI CGRYCG 1 cut(s) 163
BstNI CCWGG 2 cut(s) 142, 171
BstPAI GACNNNNGTC 1 cut(s) 9
BstSCI CCNGG 2 cut(s) 140, 169
CciI TCATGA 1 cut(s) 207
Cfr10I RCCGGY 1 cut(s) 158
Cfr13I GGNCC 2 cut(s) 4, 137
CseI GACGC 1 cut(s) 269
CviAII CATG 2 cut(s) 88, 208
CviJI RGCY 2 cut(s) 130, 158
CviKI_1 RGCY 2 cut(s) 130, 158
DpnI GATC 2 cut(s) 45, 206
DpnII GATC 2 cut(s) 43, 204
Eam1104I CTCTTC 1 cut(s) 48
EarI CTCTTC 1 cut(s) 48
Eco32I GATATC 1 cut(s) 109
Eco47I GGWCC 2 cut(s) 4, 137
Eco57I CTGAAG 1 cut(s) 72
EcoRI GAATTC 1 cut(s) 77
EcoRII CCWGG 2 cut(s) 140, 169
EcoRV GATATC 1 cut(s) 109
FaeI CATG 2 cut(s) 91, 211
FaiI YATR 5 cut(s) 83, 89, 126, 209, 249
FatI CATG 2 cut(s) 87, 207
FbaI TGATCA 1 cut(s) 43
FspBI CTAG 1 cut(s) 191
HapII CCGG 1 cut(s) 159
HgaI GACGC 1 cut(s) 269
Hin1II CATG 2 cut(s) 91, 211
HinfI GANTC 1 cut(s) 166
HpaII CCGG 1 cut(s) 159
HphI GGTGA 1 cut(s) 25
Hpy188I TCNGA 3 cut(s) 18, 52, 165
Hpy188III TCNNGA 1 cut(s) 208
Hpy99I CGWCG 2 cut(s) 18, 279
HpyCH4IV ACGT 1 cut(s) 224
HpySE526I ACGT 1 cut(s) 224
Hsp92II CATG 2 cut(s) 91, 211
Ksp22I TGATCA 1 cut(s) 43
Kzo9I GATC 2 cut(s) 43, 204
LpnPI CCDG 5 cut(s) 127, 154, 156, 172, 183
MaeI CTAG 1 cut(s) 191
MaeII ACGT 1 cut(s) 224
MalI GATC 2 cut(s) 45, 206
MboI GATC 2 cut(s) 43, 204
MboII GAAGA 4 cut(s) 65, 113, 116, 197
MluCI AATT 2 cut(s) 77, 267
MmeI TCCRAC 2 cut(s) 115, 143
MnlI CCTC 4 cut(s) 49, 122, 189, 250
MseI TTAA 3 cut(s) 152, 285, 294
MslI CAYNNNNRTG 1 cut(s) 86
MspI CCGG 1 cut(s) 159
MspR9I CCNGG 2 cut(s) 142, 171
MvaI CCWGG 2 cut(s) 142, 171
NdeII GATC 2 cut(s) 43, 204
NlaIII CATG 2 cut(s) 91, 211
NlaIV GGNNCC 1 cut(s) 139
PagI TCATGA 1 cut(s) 207
PcsI WCGNNNNNNNCGW 1 cut(s) 19
PfeI GAWTC 1 cut(s) 166
PshAI GACNNNNGTC 1 cut(s) 9
Psp6I CCWGG 2 cut(s) 140, 169
PspGI CCWGG 2 cut(s) 140, 169
PspN4I GGNNCC 1 cut(s) 139
PspPI GGNCC 2 cut(s) 4, 137
RseI CAYNNNNRTG 1 cut(s) 86
SaqAI TTAA 3 cut(s) 152, 285, 294
Sau3AI GATC 2 cut(s) 43, 204
Sau96I GGNCC 2 cut(s) 4, 137
ScrFI CCNGG 2 cut(s) 142, 171
SetI ASST 5 cut(s) 60, 146, 175, 200, 227
SinI GGWCC 2 cut(s) 4, 137
SmiMI CAYNNNNRTG 1 cut(s) 86
Sse9I AATT 2 cut(s) 77, 267
SspMI CTAG 1 cut(s) 191
StyD4I CCNGG 2 cut(s) 140, 169
TaiI ACGT 1 cut(s) 227
TaqI TCGA 3 cut(s) 118, 175, 277
TaqII GACCGA 1 cut(s) 21
TasI AATT 2 cut(s) 77, 267
TfiI GAWTC 1 cut(s) 166
Tru1I TTAA 3 cut(s) 152, 285, 294
Tru9I TTAA 3 cut(s) 152, 285, 294
TspDTI ATGAA 3 cut(s) 70, 84, 224
VpaK11BI GGWCC 2 cut(s) 4, 137
XapI RAATTY 1 cut(s) 77
XspI CTAG 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.