Prupe.2G307600_v2.0.a1
MYB Family

Transcription factor

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
29219966 .. 29221742
1777 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G307600.1

Sequence Viewer

Length: 324 bp
ATGCATGATGACAAAGTCTGGTTTCTAGCGCAGATCATGGACCGATGTCGTCGAAAACGACCCAAAACCGCCACTTCTGAGTCTGACGAGGTTATTAGCAATGAATGGGAATTCATAAACATGACTGAACAAGAAGAAGATCTCCTCTATAGAATGTATAGGCTCGTTGGGCCCAGGTGGGATTTAATAGCCGGTCGGATTCCAGGTCGAAAACCAGAAGAATTAGAGAGATATTGGATCATGAGACATTGTGATACGTTTGCTGACAAAAGAAATCAGCAAACGAAAGACAACTCTAAAAAATGTTGGTCGTCGAATGTTTAA

Protein Analysis

108

Amino Acids

13.06

Weight (kDa)

7.71

Isoelectric Point (pI)

50.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 69
AclWI GGATC 1 cut(s) 245
AcsI RAATTY 1 cut(s) 110
AjnI CCWGG 2 cut(s) 173, 202
Alw26I GTCTC 1 cut(s) 238
AlwI GGATC 1 cut(s) 245
AoxI GGCC 1 cut(s) 170
ApaI GGGCCC 1 cut(s) 174
ApoI RAATTY 1 cut(s) 110
AspLEI GCGC 1 cut(s) 31
AspS9I GGNCC 3 cut(s) 40, 170, 171
AvaII GGWCC 1 cut(s) 40
BaeGI GKGCMC 1 cut(s) 174
BanII GRGCYC 1 cut(s) 174
BciT130I CCWGG 2 cut(s) 175, 204
BcoDI GTCTC 1 cut(s) 238
BfaI CTAG 1 cut(s) 26
BfmI CTRYAG 1 cut(s) 148
BglII AGATCT 1 cut(s) 139
Bme1390I CCNGG 2 cut(s) 175, 204
Bme18I GGWCC 1 cut(s) 40
BmgT120I GGNCC 3 cut(s) 40, 170, 171
BmiI GGNNCC 1 cut(s) 172
BmrFI CCNGG 2 cut(s) 175, 204
BoxI GACNNNNGTC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 173
Bse118I RCCGGY 1 cut(s) 191
Bse3DI GCAATG 1 cut(s) 106
BseBI CCWGG 2 cut(s) 175, 204
BseDI CCNNGG 1 cut(s) 173
BseMI GCAATG 1 cut(s) 106
BseMII CTCAG 1 cut(s) 69
BseRI GAGGAG 1 cut(s) 134
BseSI GKGCMC 1 cut(s) 174
Bsh1285I CGRYCG 1 cut(s) 196
BshFI GGCC 1 cut(s) 172
BsiEI CGRYCG 1 cut(s) 196
BsiSI CCGG 1 cut(s) 192
BsmAI GTCTC 1 cut(s) 238
BsnI GGCC 1 cut(s) 172
Bsp120I GGGCCC 1 cut(s) 170
Bsp1286I GDGCHC 1 cut(s) 174
Bsp143I GATC 3 cut(s) 33, 139, 237
BspACI CCGC 1 cut(s) 69
BspANI GGCC 1 cut(s) 172
BspCNI CTCAG 1 cut(s) 70
BspHI TCATGA 1 cut(s) 240
BspLI GGNNCC 1 cut(s) 172
BspPI GGATC 1 cut(s) 245
BsrDI GCAATG 1 cut(s) 106
BsrFI RCCGGY 1 cut(s) 191
BssAI RCCGGY 1 cut(s) 191
BssECI CCNNGG 1 cut(s) 173
BssMI GATC 3 cut(s) 33, 139, 237
Bst2UI CCWGG 2 cut(s) 175, 204
BstDEI CTNAG 1 cut(s) 78
BstHHI GCGC 1 cut(s) 31
BstKTI GATC 3 cut(s) 36, 142, 240
BstMAI GTCTC 1 cut(s) 238
BstMBI GATC 3 cut(s) 33, 139, 237
BstMCI CGRYCG 1 cut(s) 196
BstMWI GCNNNNNNNGC 1 cut(s) 169
BstNI CCWGG 2 cut(s) 175, 204
BstPAI GACNNNNGTC 1 cut(s) 45
BstSCI CCNGG 2 cut(s) 173, 202
BstSFI CTRYAG 1 cut(s) 148
BstSLI GKGCMC 1 cut(s) 174
BstX2I RGATCY 1 cut(s) 139
BstYI RGATCY 1 cut(s) 139
BsuRI GGCC 1 cut(s) 172
CciI TCATGA 1 cut(s) 240
CfoI GCGC 1 cut(s) 31
Cfr10I RCCGGY 1 cut(s) 191
Cfr13I GGNCC 3 cut(s) 40, 170, 171
CviAII CATG 4 cut(s) 5, 37, 121, 241
CviJI RGCY 3 cut(s) 163, 172, 191
CviKI_1 RGCY 3 cut(s) 163, 172, 191
DdeI CTNAG 1 cut(s) 78
DpnI GATC 3 cut(s) 35, 141, 239
DpnII GATC 3 cut(s) 33, 139, 237
Eco24I GRGCYC 1 cut(s) 174
Eco47I GGWCC 1 cut(s) 40
EcoRI GAATTC 1 cut(s) 110
EcoRII CCWGG 2 cut(s) 173, 202
EcoT22I ATGCAT 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 174
FaeI CATG 4 cut(s) 8, 40, 124, 244
FaiI YATR 7 cut(s) 6, 38, 116, 122, 150, 159, 242
FatI CATG 4 cut(s) 4, 36, 120, 240
FriOI GRGCYC 1 cut(s) 174
FspBI CTAG 1 cut(s) 26
GlaI GCGC 1 cut(s) 30
HaeIII GGCC 1 cut(s) 172
HapII CCGG 1 cut(s) 192
HhaI GCGC 1 cut(s) 31
Hin1II CATG 4 cut(s) 8, 40, 124, 244
Hin6I GCGC 1 cut(s) 29
HinP1I GCGC 1 cut(s) 29
HinfI GANTC 2 cut(s) 80, 199
HpaII CCGG 1 cut(s) 192
Hpy188I TCNGA 3 cut(s) 79, 85, 198
Hpy188III TCNNGA 1 cut(s) 241
Hpy99I CGWCG 2 cut(s) 54, 316
HpyCH4IV ACGT 1 cut(s) 257
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 169
HpyF3I CTNAG 1 cut(s) 78
HpySE526I ACGT 1 cut(s) 257
Hsp92II CATG 4 cut(s) 8, 40, 124, 244
HspAI GCGC 1 cut(s) 29
Kzo9I GATC 3 cut(s) 33, 139, 237
LpnPI CCDG 7 cut(s) 4, 160, 187, 189, 205, 216, 228
MaeI CTAG 1 cut(s) 26
MaeII ACGT 1 cut(s) 257
MalI GATC 3 cut(s) 35, 141, 239
MboI GATC 3 cut(s) 33, 139, 237
MboII GAAGA 3 cut(s) 146, 149, 230
MflI RGATCY 1 cut(s) 139
MhlI GDGCHC 1 cut(s) 174
MluCI AATT 2 cut(s) 110, 221
MlyI GAGTC 1 cut(s) 89
MmeI TCCRAC 1 cut(s) 176
MnlI CCTC 2 cut(s) 82, 155
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 185, 322
MslI CAYNNNNRTG 1 cut(s) 119
MspI CCGG 1 cut(s) 192
MspR9I CCNGG 2 cut(s) 175, 204
MvaI CCWGG 2 cut(s) 175, 204
MwoI GCNNNNNNNGC 1 cut(s) 169
NdeII GATC 3 cut(s) 33, 139, 237
NlaIII CATG 4 cut(s) 8, 40, 124, 244
NlaIV GGNNCC 1 cut(s) 172
NsiI ATGCAT 1 cut(s) 6
PagI TCATGA 1 cut(s) 240
PcsI WCGNNNNNNNCGW 1 cut(s) 55
PfeI GAWTC 1 cut(s) 199
PflFI GACNNNGTC 1 cut(s) 14
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
PshAI GACNNNNGTC 1 cut(s) 45
Psp6I CCWGG 2 cut(s) 173, 202
PspGI CCWGG 2 cut(s) 173, 202
PspN4I GGNNCC 1 cut(s) 172
PspOMI GGGCCC 1 cut(s) 170
PspPI GGNCC 3 cut(s) 40, 170, 171
PsuI RGATCY 1 cut(s) 139
PsyI GACNNNGTC 1 cut(s) 14
RseI CAYNNNNRTG 1 cut(s) 119
SaqAI TTAA 2 cut(s) 185, 322
Sau3AI GATC 3 cut(s) 33, 139, 237
Sau96I GGNCC 3 cut(s) 40, 170, 171
SchI GAGTC 1 cut(s) 89
ScrFI CCNGG 2 cut(s) 175, 204
SduI GDGCHC 1 cut(s) 174
SetI ASST 4 cut(s) 93, 179, 208, 260
SfcI CTRYAG 1 cut(s) 148
SinI GGWCC 1 cut(s) 40
SmiMI CAYNNNNRTG 1 cut(s) 119
Sse9I AATT 2 cut(s) 110, 221
SsiI CCGC 1 cut(s) 69
SspMI CTAG 1 cut(s) 26
StyD4I CCNGG 2 cut(s) 173, 202
TaiI ACGT 1 cut(s) 260
TaqI TCGA 3 cut(s) 52, 208, 314
TaqII GACCGA 1 cut(s) 57
TasI AATT 2 cut(s) 110, 221
TfiI GAWTC 1 cut(s) 199
Tru1I TTAA 2 cut(s) 185, 322
Tru9I TTAA 2 cut(s) 185, 322
TspDTI ATGAA 2 cut(s) 103, 117
Tth111I GACNNNGTC 1 cut(s) 14
VpaK11BI GGWCC 1 cut(s) 40
XapI RAATTY 1 cut(s) 110
XspI CTAG 1 cut(s) 26
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.