RchiOBHm_Chr7g0195181
MYB Family

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
13111843 .. 13112254
412 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17454

Sequence Viewer

Length: 186 bp
ATGAGTCAGAATATGGATAATCTTCTACAAGATAGTACCATTTCCATTTCCAGTAGTAGTATTACTACTTCCATTAACTCAGAAGGTCTAGCAGAAGTGAGCAGTATGGACTGCGAGCTAATAAATATGAGTGAACAAGAGAAGGATCTGATCAACAGGATGTACAGAATGGTTGGAGATAGGTAA

Protein Analysis

61

Amino Acids

6.82

Weight (kDa)

4.11

Isoelectric Point (pI)

62.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 153
AfaI GTAC 2 cut(s) 37, 164
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
AlwI GGATC 1 cut(s) 153
BarI GAAGNNNNNNTAC 2 cut(s) 52, 84
BclI TGATCA 1 cut(s) 150
BfaI CTAG 1 cut(s) 89
Bse1I ACTGG 1 cut(s) 51
BseGI GGATG 1 cut(s) 165
BseMII CTCAG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 51
Bsp1407I TGTACA 1 cut(s) 162
Bsp143I GATC 2 cut(s) 145, 150
BspCNI CTCAG 1 cut(s) 92
BspPI GGATC 1 cut(s) 153
BsrGI TGTACA 1 cut(s) 162
BsrI ACTGG 1 cut(s) 51
BssMI GATC 2 cut(s) 145, 150
BstAUI TGTACA 1 cut(s) 162
BstC8I GCNNGC 1 cut(s) 116
BstDEI CTNAG 1 cut(s) 79
BstF5I GGATG 1 cut(s) 165
BstKTI GATC 2 cut(s) 148, 153
BstMBI GATC 2 cut(s) 145, 150
BstX2I RGATCY 1 cut(s) 145
BstYI RGATCY 1 cut(s) 145
BtsCI GGATG 1 cut(s) 165
Cac8I GCNNGC 1 cut(s) 116
Csp6I GTAC 2 cut(s) 36, 163
CviJI RGCY 1 cut(s) 118
CviKI_1 RGCY 1 cut(s) 118
CviQI GTAC 2 cut(s) 36, 163
DdeI CTNAG 1 cut(s) 79
DpnI GATC 2 cut(s) 147, 152
DpnII GATC 2 cut(s) 145, 150
FaiI YATR 3 cut(s) 14, 107, 128
FbaI TGATCA 1 cut(s) 150
FokI GGATG 1 cut(s) 172
FspBI CTAG 1 cut(s) 89
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 134
Hpy188I TCNGA 3 cut(s) 9, 82, 150
Hpy8I GTNNAC 1 cut(s) 134
HpyAV CCTTC 2 cut(s) 77, 136
HpyF3I CTNAG 1 cut(s) 79
Ksp22I TGATCA 1 cut(s) 150
Kzo9I GATC 2 cut(s) 145, 150
LpnPI CCDG 2 cut(s) 64, 142
MaeI CTAG 1 cut(s) 89
MalI GATC 2 cut(s) 147, 152
MboI GATC 2 cut(s) 145, 150
MboII GAAGA 1 cut(s) 14
MflI RGATCY 1 cut(s) 145
MlyI GAGTC 1 cut(s) 13
MmeI TCCRAC 1 cut(s) 154
MseI TTAA 1 cut(s) 75
NdeII GATC 2 cut(s) 145, 150
PleI GAGTC 1 cut(s) 12
PpsI GAGTC 1 cut(s) 12
PsuI RGATCY 1 cut(s) 145
RsaI GTAC 2 cut(s) 37, 164
RsaNI GTAC 2 cut(s) 36, 163
SaqAI TTAA 1 cut(s) 75
Sau3AI GATC 2 cut(s) 145, 150
SchI GAGTC 1 cut(s) 13
SetI ASST 3 cut(s) 88, 120, 185
SgeI CNNG 6 cut(s) 41, 63, 101, 127, 149, 169
SspMI CTAG 1 cut(s) 89
TatI WGTACW 1 cut(s) 162
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.