Rorug01G0418000
MYB Family

RNA polymerase sigma factor sigE, chloroplastic

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
52025155 .. 52027793
2639 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0418000.1

Sequence Viewer

Length: 297 bp
ATGGCTCAATCAAGTTCGGAAGAATCCGACTTGTTCTCCATATTCACTGATTTATTTTTTGAAAAAGCAAAAGCAAAAGCAAAACCAAAACCACAATCCCAACCAAAACCACCACCACAACCAAAACCGAAGAGTACTCCTAGTCAACGTCAGGATGAGCTTGTGAAGAAATTTCCAGGGTCAAAGATTATTCGTCGTCCAAATCCAATGGAAGAAGCCGATGATTCAACTTACATTAAATTTCCAGAACATGACTGCGGGAATTATATGGAAAGATTCTATGAGGAGGACAATTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.34

Weight (kDa)

5.85

Isoelectric Point (pI)

75.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 258
AcsI RAATTY 2 cut(s) 170, 239
AfaI GTAC 1 cut(s) 136
AgsI TTSAA 2 cut(s) 62, 228
AjnI CCWGG 1 cut(s) 175
AluBI AGCT 1 cut(s) 160
AluI AGCT 1 cut(s) 160
ApoI RAATTY 2 cut(s) 170, 239
BciT130I CCWGG 1 cut(s) 177
BfaI CTAG 1 cut(s) 141
BmcAI AGTACT 1 cut(s) 136
Bme1390I CCNGG 1 cut(s) 177
BmrFI CCNGG 1 cut(s) 177
BsaJI CCNNGG 1 cut(s) 176
BsaXI ACNNNNNCTCC 2 cut(s) 20, 50
BseBI CCWGG 1 cut(s) 177
BseDI CCNNGG 1 cut(s) 176
BseGI GGATG 1 cut(s) 160
BspACI CCGC 1 cut(s) 258
BssECI CCNNGG 1 cut(s) 176
Bst2UI CCWGG 1 cut(s) 177
Bst6I CTCTTC 1 cut(s) 125
BstF5I GGATG 1 cut(s) 160
BstNI CCWGG 1 cut(s) 177
BstSCI CCNGG 1 cut(s) 175
BtsCI GGATG 1 cut(s) 160
BtsIMutI CAGTG 1 cut(s) 45
Csp6I GTAC 1 cut(s) 135
CviAII CATG 1 cut(s) 251
CviJI RGCY 3 cut(s) 5, 160, 218
CviKI_1 RGCY 3 cut(s) 5, 160, 218
CviQI GTAC 1 cut(s) 135
Eam1104I CTCTTC 1 cut(s) 125
EarI CTCTTC 1 cut(s) 125
EcoRII CCWGG 1 cut(s) 175
FaeI CATG 1 cut(s) 254
FaiI YATR 5 cut(s) 41, 252, 267, 269, 282
FatI CATG 1 cut(s) 250
FauI CCCGC 1 cut(s) 251
FokI GGATG 1 cut(s) 167
FspBI CTAG 1 cut(s) 141
Hin1II CATG 1 cut(s) 254
HincII GTYRAC 1 cut(s) 146
HindII GTYRAC 1 cut(s) 146
HinfI GANTC 3 cut(s) 23, 224, 276
Hpy166II GTNNAC 1 cut(s) 146
Hpy188I TCNGA 2 cut(s) 19, 28
Hpy188III TCNNGA 2 cut(s) 152, 245
Hpy8I GTNNAC 1 cut(s) 146
Hpy99I CGWCG 1 cut(s) 198
HpyCH4IV ACGT 1 cut(s) 148
HpySE526I ACGT 1 cut(s) 148
Hsp92II CATG 1 cut(s) 254
LpnPI CCDG 4 cut(s) 137, 162, 189, 258
MaeI CTAG 1 cut(s) 141
MaeII ACGT 1 cut(s) 148
MboII GAAGA 4 cut(s) 32, 142, 178, 224
MluCI AATT 4 cut(s) 170, 239, 262, 292
MmeI TCCRAC 1 cut(s) 51
MnlI CCTC 2 cut(s) 277, 280
MseI TTAA 1 cut(s) 237
MspR9I CCNGG 1 cut(s) 177
MvaI CCWGG 1 cut(s) 177
NlaIII CATG 1 cut(s) 254
PfeI GAWTC 3 cut(s) 23, 224, 276
Psp6I CCWGG 1 cut(s) 175
PspGI CCWGG 1 cut(s) 175
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 237
ScaI AGTACT 1 cut(s) 136
ScrFI CCNGG 1 cut(s) 177
SetI ASST 2 cut(s) 151, 162
Sse9I AATT 4 cut(s) 170, 239, 262, 292
SsiI CCGC 1 cut(s) 258
SspMI CTAG 1 cut(s) 141
StyD4I CCNGG 1 cut(s) 175
TaiI ACGT 1 cut(s) 151
TasI AATT 4 cut(s) 170, 239, 262, 292
TatI WGTACW 1 cut(s) 134
TfiI GAWTC 3 cut(s) 23, 224, 276
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TscAI CASTG 1 cut(s) 52
TspRI CASTG 1 cut(s) 52
XapI RAATTY 2 cut(s) 170, 239
XspI CTAG 1 cut(s) 141
ZrmI AGTACT 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.