MD10G1334400.v1.1

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Forward (+)
41189214 .. 41189569
356 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1334400.v1.1.491

Sequence Viewer

Length: 144 bp
ATGAGCTACTTAGGTTTAACTGGAACTATTCATGAAAGTGTGGGTAATCTTAGAAGCCTAACCTACCTCATTCTATCCAACAACACACTTCATGGCGGAATACCAGATACCTTTGGGAAATTGAAGAATCTCCAAGTCCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

48

Amino Acids

5.1

Weight (kDa)

8.23

Isoelectric Point (pI)

30.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 96
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 1 cut(s) 6
AluI AGCT 1 cut(s) 6
Bse1I ACTGG 1 cut(s) 25
BseNI ACTGG 1 cut(s) 25
BspACI CCGC 1 cut(s) 96
BspHI TCATGA 1 cut(s) 31
BsrI ACTGG 1 cut(s) 25
BstDEI CTNAG 2 cut(s) 10, 50
CciI TCATGA 1 cut(s) 31
CviAII CATG 2 cut(s) 32, 92
CviJI RGCY 2 cut(s) 6, 57
CviKI_1 RGCY 2 cut(s) 6, 57
DdeI CTNAG 2 cut(s) 10, 50
EciI GGCGGA 1 cut(s) 111
FaeI CATG 2 cut(s) 35, 95
FaiI YATR 2 cut(s) 33, 93
FatI CATG 2 cut(s) 31, 91
Hin1II CATG 2 cut(s) 35, 95
HinfI GANTC 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 32
HpyF3I CTNAG 2 cut(s) 10, 50
Hsp92II CATG 2 cut(s) 35, 95
LpnPI CCDG 2 cut(s) 6, 117
MboII GAAGA 1 cut(s) 136
MluCI AATT 1 cut(s) 119
MmeI TCCRAC 1 cut(s) 102
MnlI CCTC 1 cut(s) 77
MseI TTAA 1 cut(s) 17
MslI CAYNNNNRTG 1 cut(s) 36
NlaIII CATG 2 cut(s) 35, 95
PagI TCATGA 1 cut(s) 31
PfeI GAWTC 1 cut(s) 127
RseI CAYNNNNRTG 1 cut(s) 36
SaqAI TTAA 1 cut(s) 17
SetI ASST 5 cut(s) 8, 16, 65, 69, 113
SgeI CNNG 4 cut(s) 33, 44, 104, 116
SmiMI CAYNNNNRTG 1 cut(s) 36
Sse9I AATT 1 cut(s) 119
SsiI CCGC 1 cut(s) 96
TasI AATT 1 cut(s) 119
TfiI GAWTC 1 cut(s) 127
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TspDTI ATGAA 3 cut(s) 20, 48, 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.