Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009010.1

Orthogroup ID

OG0010561

Physical Location & Seq

Genomic Coordinates Forward (+)

6095 .. 6673

Gene Structure 579 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009010.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 579 bp

atgaaaggtttgctatctccttcaataacactcctatcctctctagaggtcatagatcttggagagctcgctggtctttctggaacaatcccaacatccatagggtttcatctccgaaagcttgttctctatggcaataggctttgtggatcaataccagaaagcattggtaagctgtcaaaccttgaagaactcgtactgcatgagaataggttttctgggtcactcccaccaagccttgggacaaatctccgaaagcttgttctctatggcaataggctttgtggatcaataccagagatctatggcaataggctttgtggatcaataccagagagcattggtaagctgtcaaaccttgaagaactcgtactgcatgagaataggttttctgggtcactcccaccaagccttgggaaccttaagaatctaaataggctacttcttcagtcaaaccaatttgtgggtagtatacctgattcattttcaaatttgacaaatttggttcatcttgatctttctagcaattctctaactggtcacacataccacagagaattggtcagcttcaggtcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8

Protein Analysis

192

Amino Acids

20.85

Weight (kDa)

7.79

Isoelectric Point (pI)

27.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010561)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g35490
malus_domestica	MD04G1242300.v1.1 MD04G1242700.v1.1 MD10G1334400.v1.1 MD13G1082800.v1.1
prunus_persica	Prupe.1G264100_v2.0.a1
pyrus_communis	pycom16g07060
rosa_chinensis	RchiOBHm_Chr4g0445141
rosa_laevigata	RLG00000005764
rosa_multiflora	Rmu_sc0009010.1_g000003 Rmu_sc0009010.1_g000004 Rmu_sc0023183.1_g000001
rosa_roxburghii	Rroxscaffold_5G00385660
rosa_rugosa	Rorug04G0359300
rosa_samantha	Rh2AG286500 Rh4AG420100 Rh4BG431800 Rh4BG431900 Rh4CG446400 Rh4DG428000
rosa_wichuraiana	Rw4G036020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	3 cut(s)	239, 413, 463
AccI	GTMKAC	1 cut(s)	472
AclWI	GGATC	3 cut(s)	157, 295, 331
AcsI	RAATTY	2 cut(s)	490, 499
AcuI	CTGAAG	2 cut(s)	431, 553
AfaI	GTAC	2 cut(s)	198, 372
AfiI	CCNNNNNNNGG	3 cut(s)	239, 413, 463
AflII	CTTAAG	1 cut(s)	422
AgsI	TTSAA	4 cut(s)	24, 188, 362, 489
AluBI	AGCT	6 cut(s)	67, 121, 175, 259, 349, 567
AluI	AGCT	6 cut(s)	67, 121, 175, 259, 349, 567
Alw21I	GWGCWC	1 cut(s)	69
AlwI	GGATC	3 cut(s)	157, 295, 331
ApoI	RAATTY	2 cut(s)	490, 499
BanII	GRGCYC	1 cut(s)	69
BarI	GAAGNNNNNNTAC	4 cut(s)	180, 212, 354, 386
Bbv12I	GWGCWC	1 cut(s)	69
BfaI	CTAG	2 cut(s)	44, 522
BfrI	CTTAAG	1 cut(s)	422
BglII	AGATCT	2 cut(s)	55, 300
BmiI	GGNNCC	1 cut(s)	419
BsaJI	CCNNGG	2 cut(s)	238, 412
Bsc4I	CCNNNNNNNGG	3 cut(s)	239, 413, 463
Bse1I	ACTGG	1 cut(s)	541
BseDI	CCNNGG	2 cut(s)	238, 412
BseGI	GGATG	1 cut(s)	95
BseLI	CCNNNNNNNGG	3 cut(s)	239, 413, 463
BseNI	ACTGG	1 cut(s)	541
BsiHKAI	GWGCWC	1 cut(s)	69
BslFI	GGGAC	1 cut(s)	256
BslI	CCNNNNNNNGG	3 cut(s)	239, 413, 463
BsmFI	GGGAC	1 cut(s)	256
Bsp1286I	GDGCHC	1 cut(s)	69
Bsp143I	GATC	6 cut(s)	55, 149, 287, 300, 323, 514
BspLI	GGNNCC	1 cut(s)	419
BspPI	GGATC	3 cut(s)	157, 295, 331
BspTI	CTTAAG	1 cut(s)	422
BsrI	ACTGG	1 cut(s)	541
BssECI	CCNNGG	2 cut(s)	238, 412
BssMI	GATC	6 cut(s)	55, 149, 287, 300, 323, 514
BssNAI	GTATAC	1 cut(s)	473
BssT1I	CCWWGG	2 cut(s)	238, 412
Bst1107I	GTATAC	1 cut(s)	473
BstAFI	CTTAAG	1 cut(s)	422
BstC8I	GCNNGC	1 cut(s)	69
BstF5I	GGATG	1 cut(s)	95
BstKTI	GATC	6 cut(s)	58, 152, 290, 303, 326, 517
BstMBI	GATC	6 cut(s)	55, 149, 287, 300, 323, 514
BstX2I	RGATCY	2 cut(s)	55, 300
BstYI	RGATCY	2 cut(s)	55, 300
BstZ17I	GTATAC	1 cut(s)	473
BtsCI	GGATG	1 cut(s)	95
Cac8I	GCNNGC	1 cut(s)	69
Csp6I	GTAC	2 cut(s)	197, 371
CviAII	CATG	2 cut(s)	203, 377
CviQI	GTAC	2 cut(s)	197, 371
DpnI	GATC	6 cut(s)	57, 151, 289, 302, 325, 516
DpnII	GATC	6 cut(s)	55, 149, 287, 300, 323, 514
Ecl136II	GAGCTC	1 cut(s)	67
Eco130I	CCWWGG	2 cut(s)	238, 412
Eco24I	GRGCYC	1 cut(s)	69
Eco53kI	GAGCTC	1 cut(s)	67
Eco57I	CTGAAG	2 cut(s)	431, 553
EcoICRI	GAGCTC	1 cut(s)	67
EcoT14I	CCWWGG	2 cut(s)	238, 412
EcoT38I	GRGCYC	1 cut(s)	69
ErhI	CCWWGG	2 cut(s)	238, 412
FaeI	CATG	2 cut(s)	206, 380
FaiI	YATR	9 cut(s)	53, 101, 132, 204, 270, 306, 378, 473, 547
FaqI	GGGAC	1 cut(s)	256
FatI	CATG	2 cut(s)	202, 376
FblI	GTMKAC	1 cut(s)	472
FokI	GGATG	1 cut(s)	82
FriOI	GRGCYC	1 cut(s)	69
FspBI	CTAG	2 cut(s)	44, 522
Hin1II	CATG	2 cut(s)	206, 380
HindIII	AAGCTT	2 cut(s)	119, 257
HinfI	GANTC	2 cut(s)	427, 479
Hpy166II	GTNNAC	1 cut(s)	473
Hpy188I	TCNGA	2 cut(s)	116, 254
Hpy188III	TCNNGA	4 cut(s)	44, 81, 512, 576
Hpy8I	GTNNAC	1 cut(s)	473
HpyAV	CCTTC	1 cut(s)	30
HpyCH4V	TGCA	2 cut(s)	202, 376
Hsp92II	CATG	2 cut(s)	206, 380
Kzo9I	GATC	6 cut(s)	55, 149, 287, 300, 323, 514
MaeI	CTAG	2 cut(s)	44, 522
MaeIII	GTNAC	3 cut(s)	222, 396, 539
MalI	GATC	6 cut(s)	57, 151, 289, 302, 325, 516
MboI	GATC	6 cut(s)	55, 149, 287, 300, 323, 514
MboII	GAAGA	3 cut(s)	200, 374, 437
MflI	RGATCY	2 cut(s)	55, 300
MhlI	GDGCHC	1 cut(s)	69
MluCI	AATT	5 cut(s)	458, 490, 499, 526, 557
MnlI	CCTC	2 cut(s)	40, 49
MseI	TTAA	1 cut(s)	423
MspCI	CTTAAG	1 cut(s)	422
NdeII	GATC	6 cut(s)	55, 149, 287, 300, 323, 514
NlaIII	CATG	2 cut(s)	206, 380
NlaIV	GGNNCC	1 cut(s)	419
NmuCI	GTSAC	3 cut(s)	222, 396, 539
PfeI	GAWTC	2 cut(s)	427, 479
PflMI	CCANNNNNTGG	3 cut(s)	239, 413, 463
Psp124BI	GAGCTC	1 cut(s)	69
PspN4I	GGNNCC	1 cut(s)	419
PsuI	RGATCY	2 cut(s)	55, 300
RsaI	GTAC	2 cut(s)	198, 372
RsaNI	GTAC	2 cut(s)	197, 371
SacI	GAGCTC	1 cut(s)	69
SaqAI	TTAA	1 cut(s)	423
Sau3AI	GATC	6 cut(s)	55, 149, 287, 300, 323, 514
SduI	GDGCHC	1 cut(s)	69
SmlI	CTYRAG	1 cut(s)	422
SmoI	CTYRAG	1 cut(s)	422
Sse9I	AATT	5 cut(s)	458, 490, 499, 526, 557
SspMI	CTAG	2 cut(s)	44, 522
SstI	GAGCTC	1 cut(s)	69
StyI	CCWWGG	2 cut(s)	238, 412
TasI	AATT	5 cut(s)	458, 490, 499, 526, 557
TfiI	GAWTC	2 cut(s)	427, 479
Tru1I	TTAA	1 cut(s)	423
Tru9I	TTAA	1 cut(s)	423
TseFI	GTSAC	3 cut(s)	222, 396, 539
Tsp45I	GTSAC	3 cut(s)	222, 396, 539
TspDTI	ATGAA	4 cut(s)	17, 98, 471, 497
Van91I	CCANNNNNTGG	3 cut(s)	239, 413, 463
Vha464I	CTTAAG	1 cut(s)	422
XapI	RAATTY	2 cut(s)	490, 499
XbaI	TCTAGA	1 cut(s)	43
XmiI	GTMKAC	1 cut(s)	472
XspI	CTAG	2 cut(s)	44, 522

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.