Rmu_sc0023183.1_g000001

Receptor protein kinase CLAVATA1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023183.1
Physical Location & Seq
Reverse (-)
1 .. 553
553 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023183.1_g000001.1.cds

Sequence Viewer

Length: 424 bp
aacgtcttcagtggagggtttcctggaaaatcatactccgattgacggatcttgaggttctcgacgcctacgacaacgactttattgggagccttccccttgagatcgctagtctcaaaaagctcaaatatctagatcttgccaggagcttcttcaccggagaaattcccagaaattattcaaatattcataacttagaatatttttccctcagcggtaacttgcttgccggaaaactttcggccagcttggctcggttgaataatctcaagggattgcatgtccagtacttaaacaatttcgacaatggaattccacttgaactggggatgttagagtcgttacaagtgcttgacatggctgactatggcctctccggcacgattccaacgactctgggctttttgaagaaccaacttcatcg

Protein Analysis

141

Amino Acids

16.0

Weight (kDa)

7.03

Isoelectric Point (pI)

20.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 215
AclWI GGATC 1 cut(s) 56
AcoI YGGCCR 1 cut(s) 242
AcsI RAATTY 2 cut(s) 164, 311
AcyI GRCGYC 1 cut(s) 65
AfaI GTAC 1 cut(s) 289
AfiI CCNNNNNNNGG 1 cut(s) 45
AgsI TTSAA 4 cut(s) 182, 261, 322, 408
AjnI CCWGG 2 cut(s) 22, 142
AluBI AGCT 3 cut(s) 123, 149, 248
AluI AGCT 3 cut(s) 123, 149, 248
Alw26I GTCTC 1 cut(s) 118
AlwI GGATC 1 cut(s) 56
AoxI GGCC 2 cut(s) 242, 369
ApoI RAATTY 2 cut(s) 164, 311
Asp700I GAANNNNTTC 2 cut(s) 177, 237
AsuHPI GGTGA 1 cut(s) 147
BbvCI CCTCAGC 1 cut(s) 211
BciT130I CCWGG 2 cut(s) 24, 144
BcoDI GTCTC 1 cut(s) 118
BfaI CTAG 2 cut(s) 110, 133
BglI GCCNNNNNGGC 2 cut(s) 250, 377
BglII AGATCT 1 cut(s) 135
BmcAI AGTACT 1 cut(s) 289
Bme1390I CCNGG 2 cut(s) 24, 144
BmiI GGNNCC 1 cut(s) 91
BmrFI CCNGG 2 cut(s) 24, 144
BmrI ACTGGG 1 cut(s) 334
BmuI ACTGGG 1 cut(s) 334
Bpu10I CCTNAGC 1 cut(s) 211
BpuEI CTTGAG 3 cut(s) 73, 121, 253
BsaHI GRCGYC 1 cut(s) 65
BsaWI WCCGGW 1 cut(s) 157
Bsc4I CCNNNNNNNGG 1 cut(s) 45
Bse1I ACTGG 2 cut(s) 285, 329
BseBI CCWGG 2 cut(s) 24, 144
BseGI GGATG 1 cut(s) 335
BseLI CCNNNNNNNGG 1 cut(s) 45
BseMII CTCAG 1 cut(s) 225
BseNI ACTGG 2 cut(s) 285, 329
BshFI GGCC 2 cut(s) 244, 371
BsiSI CCGG 3 cut(s) 158, 230, 377
BslI CCNNNNNNNGG 1 cut(s) 45
BsmAI GTCTC 1 cut(s) 118
BsnI GGCC 2 cut(s) 244, 371
Bsp143I GATC 3 cut(s) 48, 104, 135
BspACI CCGC 1 cut(s) 215
BspANI GGCC 2 cut(s) 244, 371
BspCNI CTCAG 1 cut(s) 224
BspLI GGNNCC 1 cut(s) 91
BspPI GGATC 1 cut(s) 56
BsrI ACTGG 2 cut(s) 285, 329
BssMI GATC 3 cut(s) 48, 104, 135
BssNI GRCGYC 1 cut(s) 65
Bst2UI CCWGG 2 cut(s) 24, 144
BstACI GRCGYC 1 cut(s) 65
BstC8I GCNNGC 2 cut(s) 227, 246
BstDEI CTNAG 2 cut(s) 195, 211
BstF5I GGATG 1 cut(s) 335
BstKTI GATC 3 cut(s) 51, 107, 138
BstMAI GTCTC 1 cut(s) 118
BstMBI GATC 3 cut(s) 48, 104, 135
BstMWI GCNNNNNNNGC 2 cut(s) 250, 377
BstNI CCWGG 2 cut(s) 24, 144
BstNSI RCATGY 1 cut(s) 283
BstSCI CCNGG 2 cut(s) 22, 142
BstX2I RGATCY 2 cut(s) 48, 135
BstYI RGATCY 2 cut(s) 48, 135
BsuRI GGCC 2 cut(s) 244, 371
BtsCI GGATG 1 cut(s) 335
BtsIMutI CAGTG 1 cut(s) 16
Cac8I GCNNGC 2 cut(s) 227, 246
CseI GACGC 1 cut(s) 73
Csp6I GTAC 1 cut(s) 288
CviAII CATG 2 cut(s) 280, 357
CviJI RGCY 9 cut(s) 92, 123, 149, 244, 248, 253, 361, 371, 401
CviKI_1 RGCY 9 cut(s) 92, 123, 149, 244, 248, 253, 361, 371, 401
CviQI GTAC 1 cut(s) 288
DdeI CTNAG 2 cut(s) 195, 211
DpnI GATC 3 cut(s) 50, 106, 137
DpnII GATC 3 cut(s) 48, 104, 135
EaeI YGGCCR 1 cut(s) 242
EcoRI GAATTC 1 cut(s) 311
EcoRII CCWGG 2 cut(s) 22, 142
FaeI CATG 2 cut(s) 283, 360
FaiI YATR 5 cut(s) 34, 191, 281, 358, 368
FatI CATG 2 cut(s) 279, 356
FokI GGATG 1 cut(s) 342
FspBI CTAG 2 cut(s) 110, 133
HaeIII GGCC 2 cut(s) 244, 371
HapII CCGG 3 cut(s) 158, 230, 377
HgaI GACGC 1 cut(s) 73
Hin1I GRCGYC 1 cut(s) 65
Hin1II CATG 2 cut(s) 283, 360
HinfI GANTC 3 cut(s) 337, 384, 393
HpaII CCGG 3 cut(s) 158, 230, 377
HphI GGTGA 1 cut(s) 147
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 3 cut(s) 52, 61, 133
Hpy99I CGWCG 1 cut(s) 67
HpyAV CCTTC 1 cut(s) 103
HpyCH4IV ACGT 1 cut(s) 3
HpyCH4V TGCA 1 cut(s) 279
HpyF10VI GCNNNNNNNGC 2 cut(s) 250, 377
HpyF3I CTNAG 2 cut(s) 195, 211
HpySE526I ACGT 1 cut(s) 3
Hsp92I GRCGYC 1 cut(s) 65
Hsp92II CATG 2 cut(s) 283, 360
Kzo9I GATC 3 cut(s) 48, 104, 135
LmnI GCTCC 2 cut(s) 89, 146
MaeI CTAG 2 cut(s) 110, 133
MaeII ACGT 1 cut(s) 3
MaeIII GTNAC 2 cut(s) 217, 341
MalI GATC 3 cut(s) 50, 106, 137
MboI GATC 3 cut(s) 48, 104, 135
MboII GAAGA 2 cut(s) 144, 420
MflI RGATCY 2 cut(s) 48, 135
MluCI AATT 4 cut(s) 164, 174, 297, 311
MlyI GAGTC 2 cut(s) 346, 387
MmeI TCCRAC 1 cut(s) 412
MnlI CCTC 4 cut(s) 8, 48, 220, 382
MroXI GAANNNNTTC 2 cut(s) 177, 237
MseI TTAA 1 cut(s) 292
MspA1I CMGCKG 1 cut(s) 215
MspI CCGG 3 cut(s) 158, 230, 377
MspR9I CCNGG 2 cut(s) 24, 144
MvaI CCWGG 2 cut(s) 24, 144
MwoI GCNNNNNNNGC 2 cut(s) 250, 377
NdeII GATC 3 cut(s) 48, 104, 135
NlaIII CATG 2 cut(s) 283, 360
NlaIV GGNNCC 1 cut(s) 91
NspI RCATGY 1 cut(s) 283
PcsI WCGNNNNNNNCGW 2 cut(s) 68, 388
PdmI GAANNNNTTC 2 cut(s) 177, 237
PfeI GAWTC 1 cut(s) 384
PfoI TCCNGGA 1 cut(s) 22
PleI GAGTC 2 cut(s) 345, 387
PpsI GAGTC 2 cut(s) 345, 387
Psp6I CCWGG 2 cut(s) 22, 142
PspGI CCWGG 2 cut(s) 22, 142
PspN4I GGNNCC 1 cut(s) 91
PsuI RGATCY 2 cut(s) 48, 135
RsaI GTAC 1 cut(s) 289
RsaNI GTAC 1 cut(s) 288
SaqAI TTAA 1 cut(s) 292
Sau3AI GATC 3 cut(s) 48, 104, 135
ScaI AGTACT 1 cut(s) 289
SchI GAGTC 2 cut(s) 346, 387
ScrFI CCNGG 2 cut(s) 24, 144
SetI ASST 5 cut(s) 6, 59, 125, 151, 250
SmlI CTYRAG 3 cut(s) 52, 100, 268
SmoI CTYRAG 3 cut(s) 52, 100, 268
Sse9I AATT 4 cut(s) 164, 174, 297, 311
SsiI CCGC 1 cut(s) 215
SspI AATATT 2 cut(s) 186, 202
SspMI CTAG 2 cut(s) 110, 133
StyD4I CCNGG 2 cut(s) 22, 142
TaiI ACGT 1 cut(s) 6
TaqI TCGA 2 cut(s) 62, 302
TasI AATT 4 cut(s) 164, 174, 297, 311
TatI WGTACW 1 cut(s) 287
TfiI GAWTC 1 cut(s) 384
Tru1I TTAA 1 cut(s) 292
Tru9I TTAA 1 cut(s) 292
TscAI CASTG 1 cut(s) 16
TspDTI ATGAA 2 cut(s) 178, 409
TspGWI ACGGA 1 cut(s) 61
TspRI CASTG 1 cut(s) 16
XapI RAATTY 2 cut(s) 164, 311
XbaI TCTAGA 1 cut(s) 132
XceI RCATGY 1 cut(s) 283
XmnI GAANNNNTTC 2 cut(s) 177, 237
XspI CTAG 2 cut(s) 110, 133
ZrmI AGTACT 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.