MD11G1111500.v1.1

CHCH-CHCH-like Cx9C, IMS import disulfide relay-system,

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
9864418 .. 9866541
2124 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1111500.v1.1.491

Sequence Viewer

Length: 177 bp
ATGAAGGAAATGATAGCATTTCTCAACTGCATGGCTCCAAACCAGCTCTGTGATGATAAGTGTGTAAAGCAGAAGGAACTTTTGGGTACTTGTATGGAGGCTCAGAGCAACAAAAACAGAAAGTCAATGGGAAGCATCAATTACCACTTGCAGAGGCTGAGCAGGGGAAGGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.69

Weight (kDa)

9.51

Isoelectric Point (pI)

48.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 88
AjuI GAANNNNNNNTTGG 2 cut(s) 65, 97
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
AlwNI CAGNNNCTG 1 cut(s) 157
BlpI GCTNAGC 1 cut(s) 158
BmiI GGNNCC 1 cut(s) 36
BmsI GCATC 1 cut(s) 144
Bpu1102I GCTNAGC 1 cut(s) 158
BseMII CTCAG 2 cut(s) 116, 149
Bsp1720I GCTNAGC 1 cut(s) 158
BspCNI CTCAG 2 cut(s) 115, 150
BspLI GGNNCC 1 cut(s) 36
BstDEI CTNAG 2 cut(s) 102, 158
CaiI CAGNNNCTG 1 cut(s) 157
Csp6I GTAC 1 cut(s) 87
CviAII CATG 1 cut(s) 31
CviJI RGCY 4 cut(s) 35, 46, 101, 157
CviKI_1 RGCY 4 cut(s) 35, 46, 101, 157
CviQI GTAC 1 cut(s) 87
DdeI CTNAG 2 cut(s) 102, 158
FaeI CATG 1 cut(s) 34
FaiI YATR 2 cut(s) 32, 95
FatI CATG 1 cut(s) 30
Hin1II CATG 1 cut(s) 34
Hpy188I TCNGA 1 cut(s) 105
HpyAV CCTTC 2 cut(s) 67, 162
HpyCH4V TGCA 2 cut(s) 30, 151
HpyF3I CTNAG 2 cut(s) 102, 158
Hsp92II CATG 1 cut(s) 34
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 2 cut(s) 56, 148
LweI GCATC 1 cut(s) 144
MluCI AATT 1 cut(s) 139
MnlI CCTC 2 cut(s) 91, 147
NlaIII CATG 1 cut(s) 34
NlaIV GGNNCC 1 cut(s) 36
PspN4I GGNNCC 1 cut(s) 36
PstNI CAGNNNCTG 1 cut(s) 157
RsaI GTAC 1 cut(s) 88
RsaNI GTAC 1 cut(s) 87
SetI ASST 1 cut(s) 48
SfaNI GCATC 1 cut(s) 144
SgeI CNNG 4 cut(s) 43, 55, 102, 160
Sse9I AATT 1 cut(s) 139
TasI AATT 1 cut(s) 139
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.