Rh6CG004200

CHCH-CHCH-like Cx9C, IMS import disulfide relay-system,

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0003131
Physical Location & Seq
Reverse (-)
574184 .. 574845
662 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG004200.1

Sequence Viewer

Length: 174 bp
ATGGGTCGCAAAGCAGGTTCGATATACATTAATCCAAAGAAATTTGGTGCTTTTCACAAACCTTGCATGAAGGAAATGGTGACATTTCTCAGTTGCTTGGCTCTTAACAGCAACTGTGATGAGAAATGTGTAAGGCAGAAGGACCTTTTGAGTACTTGCATGGATTCTCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CX9C

Protein Analysis

57

Amino Acids

6.42

Weight (kDa)

8.95

Isoelectric Point (pI)

42.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CX9C PF16860 20 - 57 1.6e-08 CHCH-CHCH-like Cx9C, IMS import disulfide relay-system,
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 5
AcsI RAATTY 1 cut(s) 41
AfaI GTAC 1 cut(s) 154
AlwNI CAGNNNCTG 1 cut(s) 114
ApoI RAATTY 1 cut(s) 41
AseI ATTAAT 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 91
AvaII GGWCC 1 cut(s) 142
BfuAI ACCTGC 1 cut(s) 5
BmcAI AGTACT 1 cut(s) 154
Bme18I GGWCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 142
BseMII CTCAG 1 cut(s) 103
BspCNI CTCAG 1 cut(s) 102
BspMI ACCTGC 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 116
BstDEI CTNAG 2 cut(s) 89, 168
BveI ACCTGC 1 cut(s) 5
CaiI CAGNNNCTG 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 153
CviAII CATG 2 cut(s) 67, 160
CviJI RGCY 1 cut(s) 101
CviKI_1 RGCY 1 cut(s) 101
CviQI GTAC 1 cut(s) 153
DdeI CTNAG 2 cut(s) 89, 168
Eco47I GGWCC 1 cut(s) 142
EcoO109I RGGNCCY 1 cut(s) 142
FaeI CATG 2 cut(s) 70, 163
FaiI YATR 3 cut(s) 25, 68, 161
FatI CATG 2 cut(s) 66, 159
Hin1II CATG 2 cut(s) 70, 163
HinfI GANTC 1 cut(s) 164
HphI GGTGA 1 cut(s) 91
HpyAV CCTTC 2 cut(s) 64, 133
HpyCH4III ACNGT 1 cut(s) 116
HpyCH4V TGCA 2 cut(s) 66, 159
HpyF3I CTNAG 2 cut(s) 89, 168
Hsp92II CATG 2 cut(s) 70, 163
MaeIII GTNAC 1 cut(s) 79
MluCI AATT 1 cut(s) 41
MseI TTAA 2 cut(s) 30, 105
NlaIII CATG 2 cut(s) 70, 163
NmuCI GTSAC 1 cut(s) 79
PfeI GAWTC 1 cut(s) 164
PpuMI RGGWCCY 1 cut(s) 142
PshBI ATTAAT 1 cut(s) 30
Psp5II RGGWCCY 1 cut(s) 142
PspPI GGNCC 1 cut(s) 142
PspPPI RGGWCCY 1 cut(s) 142
PstNI CAGNNNCTG 1 cut(s) 114
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
SaqAI TTAA 2 cut(s) 30, 105
Sau96I GGNCC 1 cut(s) 142
ScaI AGTACT 1 cut(s) 154
SetI ASST 3 cut(s) 19, 64, 147
SgeI CNNG 5 cut(s) 27, 75, 79, 109, 168
SinI GGWCC 1 cut(s) 142
Sse9I AATT 1 cut(s) 41
TaaI ACNGT 1 cut(s) 116
TaqI TCGA 1 cut(s) 20
TasI AATT 1 cut(s) 41
TatI WGTACW 1 cut(s) 152
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 2 cut(s) 30, 105
Tru9I TTAA 2 cut(s) 30, 105
TseFI GTSAC 1 cut(s) 79
Tsp45I GTSAC 1 cut(s) 79
TspDTI ATGAA 1 cut(s) 83
VpaK11BI GGWCC 1 cut(s) 142
VspI ATTAAT 1 cut(s) 30
XapI RAATTY 1 cut(s) 41
ZrmI AGTACT 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.