Rmu_sc0017347.1_g000004

CHCH-CHCH-like Cx9C, IMS import disulfide relay-system,

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017347.1
Physical Location & Seq
Forward (+)
23551 .. 23957
407 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017347.1_g000004.1.cds

Sequence Viewer

Length: 240 bp
atgggtcgcaaagcaggttcgatatacattaatccaaagaaatttggtgcttttcacaaaccttgcatgaaggaaatggtgacatttctcagttgcttggctcttaacagcaactgtgatgagaaatgtgtaaggcagaaggaccttttgagtacttgcatggattctcagagcaagaaaaacaagtcaatgggaagcattaattaccacttgcagaggctgagcaggggaaggaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.99

Weight (kDa)

9.87

Isoelectric Point (pI)

48.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 5
AcsI RAATTY 1 cut(s) 41
AfaI GTAC 1 cut(s) 154
AlwNI CAGNNNCTG 2 cut(s) 114, 220
ApoI RAATTY 1 cut(s) 41
AseI ATTAAT 2 cut(s) 30, 201
AspS9I GGNCC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 91
AvaII GGWCC 1 cut(s) 142
BfuAI ACCTGC 1 cut(s) 5
BlpI GCTNAGC 1 cut(s) 221
BmcAI AGTACT 1 cut(s) 154
Bme18I GGWCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 142
Bpu1102I GCTNAGC 1 cut(s) 221
BseMII CTCAG 3 cut(s) 103, 182, 212
Bsp1720I GCTNAGC 1 cut(s) 221
BspCNI CTCAG 3 cut(s) 102, 181, 213
BspMI ACCTGC 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 116
BstDEI CTNAG 3 cut(s) 89, 168, 221
BveI ACCTGC 1 cut(s) 5
CaiI CAGNNNCTG 2 cut(s) 114, 220
Cfr13I GGNCC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 153
CviAII CATG 2 cut(s) 67, 160
CviJI RGCY 2 cut(s) 101, 220
CviKI_1 RGCY 2 cut(s) 101, 220
CviQI GTAC 1 cut(s) 153
DdeI CTNAG 3 cut(s) 89, 168, 221
Eco47I GGWCC 1 cut(s) 142
EcoO109I RGGNCCY 1 cut(s) 142
FaeI CATG 2 cut(s) 70, 163
FaiI YATR 3 cut(s) 25, 68, 161
FatI CATG 2 cut(s) 66, 159
Hin1II CATG 2 cut(s) 70, 163
HinfI GANTC 1 cut(s) 164
HphI GGTGA 1 cut(s) 91
Hpy188I TCNGA 1 cut(s) 171
HpyAV CCTTC 3 cut(s) 64, 133, 225
HpyCH4III ACNGT 1 cut(s) 116
HpyCH4V TGCA 3 cut(s) 66, 159, 214
HpyF3I CTNAG 3 cut(s) 89, 168, 221
Hsp92II CATG 2 cut(s) 70, 163
LpnPI CCDG 1 cut(s) 211
MaeIII GTNAC 1 cut(s) 79
MluCI AATT 2 cut(s) 41, 202
MnlI CCTC 1 cut(s) 210
MseI TTAA 3 cut(s) 30, 105, 201
NlaIII CATG 2 cut(s) 70, 163
NmuCI GTSAC 1 cut(s) 79
PfeI GAWTC 1 cut(s) 164
PpuMI RGGWCCY 1 cut(s) 142
PshBI ATTAAT 2 cut(s) 30, 201
Psp5II RGGWCCY 1 cut(s) 142
PspPI GGNCC 1 cut(s) 142
PspPPI RGGWCCY 1 cut(s) 142
PstNI CAGNNNCTG 2 cut(s) 114, 220
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
SaqAI TTAA 3 cut(s) 30, 105, 201
Sau96I GGNCC 1 cut(s) 142
ScaI AGTACT 1 cut(s) 154
SetI ASST 3 cut(s) 19, 64, 147
SgeI CNNG 9 cut(s) 27, 75, 79, 109, 168, 172, 187, 196, 223
SinI GGWCC 1 cut(s) 142
Sse9I AATT 2 cut(s) 41, 202
TaaI ACNGT 1 cut(s) 116
TaqI TCGA 1 cut(s) 20
TasI AATT 2 cut(s) 41, 202
TatI WGTACW 1 cut(s) 152
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 3 cut(s) 30, 105, 201
Tru9I TTAA 3 cut(s) 30, 105, 201
TseFI GTSAC 1 cut(s) 79
Tsp45I GTSAC 1 cut(s) 79
TspDTI ATGAA 1 cut(s) 83
VpaK11BI GGWCC 1 cut(s) 142
VspI ATTAAT 2 cut(s) 30, 201
XapI RAATTY 1 cut(s) 41
ZrmI AGTACT 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.