Rh5BG435600

CHCH-CHCH-like Cx9C, IMS import disulfide relay-system,

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0003131
Physical Location & Seq
Forward (+)
70088904 .. 70091210
2307 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG435600.1

Sequence Viewer

Length: 243 bp
ATGGGTCGCAAAGCAGGTTCGATATACATTAATCCAAAGAAATTTGGTGCTTTTCACAAACCTTGCATGAAGGAAATGGTAACATTTCTCAGTTGCTTGGCTCTTAACACCAACTGTGATGAGAAGTGTGTAAGGCAGAAGGACCTTTTGAGTACTTGTATGGATTCTCAGAGCAAGAAAAACAATCATCGGGTGGCAGATGATCTAGGATATAAGCTTTGTGATTTTTACAATTTGAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CX9C

Protein Analysis

80

Amino Acids

9.18

Weight (kDa)

9.13

Isoelectric Point (pI)

40.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CX9C PF16860 20 - 57 2.4e-08 CHCH-CHCH-like Cx9C, IMS import disulfide relay-system,
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 5
AcsI RAATTY 1 cut(s) 41
AfaI GTAC 1 cut(s) 154
AluBI AGCT 1 cut(s) 217
AluI AGCT 1 cut(s) 217
ApoI RAATTY 1 cut(s) 41
AseI ATTAAT 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 142
AvaII GGWCC 1 cut(s) 142
BfaI CTAG 1 cut(s) 206
BfuAI ACCTGC 1 cut(s) 5
BmcAI AGTACT 1 cut(s) 154
Bme18I GGWCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 142
BseMII CTCAG 2 cut(s) 103, 182
Bsp143I GATC 1 cut(s) 202
BspCNI CTCAG 2 cut(s) 102, 181
BspMI ACCTGC 1 cut(s) 5
BssMI GATC 1 cut(s) 202
Bst4CI ACNGT 1 cut(s) 116
BstDEI CTNAG 2 cut(s) 89, 168
BstKTI GATC 1 cut(s) 205
BstMBI GATC 1 cut(s) 202
BveI ACCTGC 1 cut(s) 5
Cfr13I GGNCC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 153
CviAII CATG 1 cut(s) 67
CviJI RGCY 2 cut(s) 101, 217
CviKI_1 RGCY 2 cut(s) 101, 217
CviQI GTAC 1 cut(s) 153
DdeI CTNAG 2 cut(s) 89, 168
DpnI GATC 1 cut(s) 204
DpnII GATC 1 cut(s) 202
Eco47I GGWCC 1 cut(s) 142
EcoO109I RGGNCCY 1 cut(s) 142
FaeI CATG 1 cut(s) 70
FaiI YATR 4 cut(s) 25, 68, 161, 213
FatI CATG 1 cut(s) 66
FspBI CTAG 1 cut(s) 206
Hin1II CATG 1 cut(s) 70
HindIII AAGCTT 1 cut(s) 215
HinfI GANTC 1 cut(s) 164
Hpy188I TCNGA 1 cut(s) 171
HpyAV CCTTC 2 cut(s) 64, 133
HpyCH4III ACNGT 1 cut(s) 116
HpyCH4V TGCA 1 cut(s) 66
HpyF3I CTNAG 2 cut(s) 89, 168
Hsp92II CATG 1 cut(s) 70
Kzo9I GATC 1 cut(s) 202
MaeI CTAG 1 cut(s) 206
MaeIII GTNAC 1 cut(s) 79
MalI GATC 1 cut(s) 204
MboI GATC 1 cut(s) 202
MluCI AATT 2 cut(s) 41, 232
MseI TTAA 2 cut(s) 30, 105
NdeII GATC 1 cut(s) 202
NlaIII CATG 1 cut(s) 70
PfeI GAWTC 1 cut(s) 164
PpuMI RGGWCCY 1 cut(s) 142
PshBI ATTAAT 1 cut(s) 30
Psp5II RGGWCCY 1 cut(s) 142
PspPI GGNCC 1 cut(s) 142
PspPPI RGGWCCY 1 cut(s) 142
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
SaqAI TTAA 2 cut(s) 30, 105
Sau3AI GATC 1 cut(s) 202
Sau96I GGNCC 1 cut(s) 142
ScaI AGTACT 1 cut(s) 154
SetI ASST 4 cut(s) 19, 64, 147, 219
SgeI CNNG 8 cut(s) 27, 75, 79, 109, 168, 187, 203, 218
SinI GGWCC 1 cut(s) 142
Sse9I AATT 2 cut(s) 41, 232
SspMI CTAG 1 cut(s) 206
TaaI ACNGT 1 cut(s) 116
TaqI TCGA 1 cut(s) 20
TasI AATT 2 cut(s) 41, 232
TatI WGTACW 1 cut(s) 152
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 2 cut(s) 30, 105
Tru9I TTAA 2 cut(s) 30, 105
TspDTI ATGAA 1 cut(s) 83
VpaK11BI GGWCC 1 cut(s) 142
VspI ATTAAT 1 cut(s) 30
XapI RAATTY 1 cut(s) 41
XspI CTAG 1 cut(s) 206
ZrmI AGTACT 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.