Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000004

Orthogroup ID

OG0003131

Physical Location & Seq

Genomic Coordinates Reverse (-)

58328611 .. 58332060

Gene Structure 3450 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug04G0423900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1137 bp

ATGGCCACTTTCACCCACCCCAAAACCTCCCTCTTCGGCGGCGCCCGCATCCCGATGCCCGCCACCACCAAGTCCCGGACTTTCGCCCCATTCCGCGTCCGGATGGCCCTCCAGGACTCCGGCCCATCCATCGCCGTCGTCGGCGTCACCGGCGCCGTCGGCCAGGAGTTCCTCTCCGTCCTCCACGACCGCGACTTCCCTTACCGCTCCATCAAAATGCTCGCCTCCAAGCGCTCCGCCGGCCAGAAACTCTCGTTCCAGGGCCGGAGCTACGTCGTCGAGGAGCTCACCGGCGGCAGCTTCGACGGCGTCGACATCGCCCTCTTCAGCGCTGGTGGGTCCATCAGCAAAGAGTTCGGGCCCATCGCCGTCGAGAAGGGCACCATTGTCGTTGACAACAGCTCGGCGTTTCGGATGCAAGACGACGTGCCGTTGGTCGTGCCGGAGGTAAACCCGGAGGCGATGGAGGGGATCAAGGCCGGAAAGGGAAAGGGGGCGCTTATTGCTAATCCTAATTGCTCCACCATTATCTGCTTGATGGCTGCTACTCCTCTACATCGTCACTCTAAGGTGAAACGTATGGTGGTTAGCACGTATCAGGCTGCTAGTGGAGCTGGTGCTGCTGCTATGAGAGAGCTTGAGCAGCAAACTCATGAGGTTCTGGAAGGGAAGCCAGTAACTTGTGAGATATTTCAGCGGCAGTATGCTTTTAATTTGTTTTCCCACAATTCAGCGGTTCTTCCAAATGGATATAATGAAGAGGAAATGAAACTAGTCAAGGAGACACGAAAAATATGGAATGACAAGGATGTCAAGGTAACTGCCACATGCATACGAGTTCCTGTAATGCGGGCACATGCTGAGAGTGTAAATCTTGAATTTGAGAATCCCCTTGATGAGGACACCGCAAGGGATATTCTGAAGAAGGCTCCTGGTGTGGTGGTTATTGATGACCGTGCAGCTAATAATTTCCCTACACCTTTGGAGGTGTCAAACAAAGATGATGTTGCAGTTGGCAGAATCCGCCGTGATGTGTCCCAAGAGGGGAACTATGGGTTGGACATTTTTGTCTGCGGTGATCAAATACGCAAGGGAGCTGCACTTAATGCTGTTCAGATTGCTGAGCTGTTGCTATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CX9C

Protein Analysis

378

Amino Acids

40.99

Weight (kDa)

7.06

Isoelectric Point (pI)

30.3

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Semialdhyde_dh	PF01118	44 - 156	1.3e-34	Semialdehyde dehydrogenase, NAD binding domain
Semialdhyde_dhC	PF02774	184 - 364	3.9e-46	Semialdehyde dehydrogenase, dimerisation domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003131)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G47278 AT1G47278 AT1G47278
fragaria_vesca	FvH4_3g35770 FvH4_3g35770 FvH4_3g35770
malus_domestica	MD02G1271300.v1.1 MD11G1111500.v1.1
prunus_persica	Prupe.6G079900_v2.0.a1
pyrus_communis	pycom11g09210
rosa_chinensis	RchiOBHm_Chr5g0006711 RchiOBHm_Chr5g0063941
rosa_laevigata	RLG00000031419
rosa_multiflora	Rmu_sc0011986.1_g000001 Rmu_sc0017347.1_g000004 Rmu_sc0018387.1_g000007
rosa_roxburghii	Rroxscaffold_1G00016840 Rroxscaffold_1G00069310
rosa_rugosa	Rorug04G0423800 Rorug04G0423900 Rorug05G0361100 Rorug05G0496800 Rorug05G0496900 Rorug05G0497000 Rorug05G0497100
rosa_samantha	Rh5AG051700 Rh5AG419800 Rh5BG435600 Rh5CG059200 Rh5CG458700 Rh5DG049700 Rh5DG448800 Rh6AG006000 Rh6CG004200 Rh6DG004100
rosa_wichuraiana	Rw5G005280 Rw5G039450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	809, 1067
AccB1I	GGYRCC	3 cut(s)	41, 152, 380
AccBSI	CCGCTC	1 cut(s)	207
AccI	GTMKAC	1 cut(s)	312
AccII	CGCG	2 cut(s)	96, 192
AccIII	TCCGGA	1 cut(s)	99
AclWI	GGATC	1 cut(s)	479
AcoI	YGGCCR	3 cut(s)	3, 160, 241
AcsI	RAATTY	1 cut(s)	878
AcuI	CTGAAG	2 cut(s)	310, 941
AcyI	GRCGYC	4 cut(s)	42, 144, 153, 309
AfeI	AGCGCT	2 cut(s)	233, 331
AfiI	CCNNNNNNNGG	3 cut(s)	75, 898, 1044
AgsI	TTSAA	1 cut(s)	878
AhlI	ACTAGT	1 cut(s)	772
AjiI	CACGTC	1 cut(s)	427
AjnI	CCWGG	4 cut(s)	111, 162, 258, 931
AjuI	GAANNNNNNNTTGG	2 cut(s)	1040, 1072
AluBI	AGCT	9 cut(s)	270, 286, 300, 402, 614, 637, 962, 1097, 1126
AluI	AGCT	9 cut(s)	270, 286, 300, 402, 614, 637, 962, 1097, 1126
Alw21I	GWGCWC	1 cut(s)	288
Alw26I	GTCTC	1 cut(s)	776
AlwI	GGATC	1 cut(s)	479
Aor13HI	TCCGGA	1 cut(s)	99
Aor51HI	AGCGCT	2 cut(s)	233, 331
AoxI	GGCC	8 cut(s)	3, 105, 121, 160, 241, 262, 359, 477
ApaI	GGGCCC	1 cut(s)	363
ApeKI	GCWGC	8 cut(s)	297, 542, 602, 620, 623, 643, 959, 1097
ApoI	RAATTY	1 cut(s)	878
AspLEI	GCGC	5 cut(s)	44, 155, 234, 332, 499
AspS9I	GGNCC	6 cut(s)	106, 122, 262, 339, 359, 360
AsuC2I	CCSGG	2 cut(s)	76, 455
AsuHPI	GGTGA	5 cut(s)	4, 139, 280, 583, 1088
AvaII	GGWCC	1 cut(s)	339
BaeGI	GKGCMC	3 cut(s)	363, 383, 856
BalI	TGGCCA	1 cut(s)	5
BanI	GGYRCC	3 cut(s)	41, 152, 380
BanII	GRGCYC	2 cut(s)	288, 363
Bbv12I	GWGCWC	1 cut(s)	288
BbvI	GCAGC	8 cut(s)	309, 529, 589, 607, 610, 655, 971, 1084
BccI	CCATC	8 cut(s)	97, 133, 137, 218, 350, 371, 457, 532
BceAI	ACGGC	6 cut(s)	119, 140, 322, 353, 415, 1011
BcgI	CGANNNNNNTGC	4 cut(s)	337, 370, 371, 404
BciT130I	CCWGG	4 cut(s)	113, 164, 260, 933
BclI	TGATCA	1 cut(s)	1078
BcnI	CCSGG	2 cut(s)	76, 455
BcoDI	GTCTC	1 cut(s)	776
BcuI	ACTAGT	1 cut(s)	772
BfaI	CTAG	2 cut(s)	606, 773
BfmI	CTRYAG	1 cut(s)	1133
BfoI	RGCGCY	5 cut(s)	45, 156, 235, 333, 500
BlpI	GCTNAGC	1 cut(s)	1122
Bme1390I	CCNGG	6 cut(s)	76, 113, 164, 260, 455, 933
Bme18I	GGWCC	1 cut(s)	339
BmgBI	CACGTC	1 cut(s)	427
BmgT120I	GGNCC	6 cut(s)	106, 122, 262, 339, 359, 360
BmiI	GGNNCC	6 cut(s)	43, 154, 340, 361, 382, 930
BmrFI	CCNGG	6 cut(s)	76, 113, 164, 260, 455, 933
BmsI	GCATC	3 cut(s)	45, 57, 405
BplI	GAGNNNNNCTC	2 cut(s)	158, 190
BpmI	CTGGAG	1 cut(s)	95
Bpu1102I	GCTNAGC	1 cut(s)	1122
BpuEI	CTTGAG	1 cut(s)	659
BpuMI	CCSGG	2 cut(s)	76, 455
BsaAI	YACGTR	1 cut(s)	594
BsaHI	GRCGYC	4 cut(s)	42, 144, 153, 309
BsaJI	CCNNGG	1 cut(s)	259
BsaWI	WCCGGW	1 cut(s)	99
Bsc4I	CCNNNNNNNGG	3 cut(s)	75, 898, 1044
Bse118I	RCCGGY	3 cut(s)	149, 239, 290
Bse1I	ACTGG	1 cut(s)	674
BseAI	TCCGGA	1 cut(s)	99
BseBI	CCWGG	4 cut(s)	113, 164, 260, 933
BseDI	CCNNGG	1 cut(s)	259
BseGI	GGATG	5 cut(s)	48, 108, 125, 420, 814
BseLI	CCNNNNNNNGG	3 cut(s)	75, 898, 1044
BseMII	CTCAG	2 cut(s)	852, 1113
BseNI	ACTGG	1 cut(s)	674
BseRI	GAGGAG	2 cut(s)	296, 540
BseSI	GKGCMC	3 cut(s)	363, 383, 856
BseXI	GCAGC	8 cut(s)	309, 529, 589, 607, 610, 655, 971, 1084
BsgI	GTGCAG	2 cut(s)	978, 1083
Bsh1236I	CGCG	2 cut(s)	96, 192
Bsh1285I	CGRYCG	1 cut(s)	190
BshFI	GGCC	8 cut(s)	5, 107, 123, 162, 243, 264, 361, 479
BshNI	GGYRCC	3 cut(s)	41, 152, 380
BsiEI	CGRYCG	1 cut(s)	190
BsiHKAI	GWGCWC	1 cut(s)	288
BslFI	GGGAC	2 cut(s)	58, 1021
BslI	CCNNNNNNNGG	3 cut(s)	75, 898, 1044
BsmAI	GTCTC	1 cut(s)	776
BsmFI	GGGAC	2 cut(s)	58, 1021
BsnI	GGCC	8 cut(s)	5, 107, 123, 162, 243, 264, 361, 479
Bsp120I	GGGCCC	1 cut(s)	359
Bsp1286I	GDGCHC	4 cut(s)	288, 363, 383, 856
Bsp13I	TCCGGA	1 cut(s)	99
Bsp143I	GATC	2 cut(s)	471, 1078
Bsp1720I	GCTNAGC	1 cut(s)	1122
BspANI	GGCC	8 cut(s)	5, 107, 123, 162, 243, 264, 361, 479
BspCNI	CTCAG	2 cut(s)	853, 1114
BspEI	TCCGGA	1 cut(s)	99
BspFNI	CGCG	2 cut(s)	96, 192
BspHI	TCATGA	1 cut(s)	652
BspLI	GGNNCC	6 cut(s)	43, 154, 340, 361, 382, 930
BspPI	GGATC	1 cut(s)	479
BspT107I	GGYRCC	3 cut(s)	41, 152, 380
BsrBI	CCGCTC	1 cut(s)	207
BsrFI	RCCGGY	3 cut(s)	149, 239, 290
BsrI	ACTGG	1 cut(s)	674
BssAI	RCCGGY	3 cut(s)	149, 239, 290
BssECI	CCNNGG	1 cut(s)	259
BssMI	GATC	2 cut(s)	471, 1078
BssNI	GRCGYC	4 cut(s)	42, 144, 153, 309
Bst2UI	CCWGG	4 cut(s)	113, 164, 260, 933
Bst4CI	ACNGT	1 cut(s)	956
Bst6I	CTCTTC	3 cut(s)	38, 329, 753
BstACI	GRCGYC	4 cut(s)	42, 144, 153, 309
BstAPI	GCANNNNNTGC	1 cut(s)	1106
BstBAI	YACGTR	1 cut(s)	594
BstC8I	GCNNGC	5 cut(s)	46, 60, 222, 241, 852
BstDEI	CTNAG	3 cut(s)	567, 861, 1122
BstENI	CCTNNNNNAGG	1 cut(s)	896
BstF5I	GGATG	5 cut(s)	48, 108, 125, 420, 814
BstFNI	CGCG	2 cut(s)	96, 192
BstH2I	RGCGCY	5 cut(s)	45, 156, 235, 333, 500
BstHHI	GCGC	5 cut(s)	44, 155, 234, 332, 499
BstKTI	GATC	2 cut(s)	474, 1081
BstMAI	GTCTC	1 cut(s)	776
BstMBI	GATC	2 cut(s)	471, 1078
BstMCI	CGRYCG	1 cut(s)	190
BstNI	CCWGG	4 cut(s)	113, 164, 260, 933
BstNSI	RCATGY	2 cut(s)	831, 860
BstSCI	CCNGG	6 cut(s)	74, 111, 162, 258, 453, 931
BstSFI	CTRYAG	1 cut(s)	1133
BstSLI	GKGCMC	3 cut(s)	363, 383, 856
BstUI	CGCG	2 cut(s)	96, 192
BstV1I	GCAGC	8 cut(s)	309, 529, 589, 607, 610, 655, 971, 1084
BsuRI	GGCC	8 cut(s)	5, 107, 123, 162, 243, 264, 361, 479
BtgZI	GCGATG	4 cut(s)	115, 301, 349, 476
BtrI	CACGTC	1 cut(s)	427
BtsCI	GGATG	5 cut(s)	48, 108, 125, 420, 814
Cac8I	GCNNGC	5 cut(s)	46, 60, 222, 241, 852
CciI	TCATGA	1 cut(s)	652
CfoI	GCGC	5 cut(s)	44, 155, 234, 332, 499
Cfr10I	RCCGGY	3 cut(s)	149, 239, 290
Cfr13I	GGNCC	6 cut(s)	106, 122, 262, 339, 359, 360
CseI	GACGC	3 cut(s)	85, 133, 298
CviAII	CATG	3 cut(s)	653, 828, 857
DdeI	CTNAG	3 cut(s)	567, 861, 1122
DinI	GGCGCC	2 cut(s)	43, 154
DpnI	GATC	2 cut(s)	473, 1080
DpnII	GATC	2 cut(s)	471, 1078
DrdI	GACNNNNNNGTC	2 cut(s)	809, 1067
DseDI	GACNNNNNNGTC	2 cut(s)	809, 1067
EaeI	YGGCCR	3 cut(s)	3, 160, 241
Eam1104I	CTCTTC	3 cut(s)	38, 329, 753
EarI	CTCTTC	3 cut(s)	38, 329, 753
EciI	GGCGGA	2 cut(s)	226, 1013
Ecl136II	GAGCTC	1 cut(s)	286
Eco24I	GRGCYC	2 cut(s)	288, 363
Eco47I	GGWCC	1 cut(s)	339
Eco47III	AGCGCT	2 cut(s)	233, 331
Eco53kI	GAGCTC	1 cut(s)	286
Eco57I	CTGAAG	2 cut(s)	310, 941
EcoICRI	GAGCTC	1 cut(s)	286
EcoNI	CCTNNNNNAGG	1 cut(s)	896
EcoRII	CCWGG	4 cut(s)	111, 162, 258, 931
EcoT22I	ATGCAT	1 cut(s)	833
EcoT38I	GRGCYC	2 cut(s)	288, 363
EgeI	GGCGCC	2 cut(s)	43, 154
EheI	GGCGCC	2 cut(s)	43, 154
FaeI	CATG	3 cut(s)	656, 831, 860
FaqI	GGGAC	2 cut(s)	58, 1021
FatI	CATG	3 cut(s)	652, 827, 856
FauI	CCCGC	3 cut(s)	53, 67, 843
FbaI	TGATCA	1 cut(s)	1078
FblI	GTMKAC	1 cut(s)	312
FokI	GGATG	5 cut(s)	35, 112, 115, 427, 821
FriOI	GRGCYC	2 cut(s)	288, 363
FspBI	CTAG	2 cut(s)	606, 773
GlaI	GCGC	5 cut(s)	43, 154, 233, 331, 498
GsuI	CTGGAG	1 cut(s)	95
HaeII	RGCGCY	5 cut(s)	45, 156, 235, 333, 500
HaeIII	GGCC	8 cut(s)	5, 107, 123, 162, 243, 264, 361, 479
HgaI	GACGC	3 cut(s)	85, 133, 298
HhaI	GCGC	5 cut(s)	44, 155, 234, 332, 499
Hin1I	GRCGYC	4 cut(s)	42, 144, 153, 309
Hin1II	CATG	3 cut(s)	656, 831, 860
Hin6I	GCGC	5 cut(s)	42, 153, 232, 330, 497
HinP1I	GCGC	5 cut(s)	42, 153, 232, 330, 497
HincII	GTYRAC	2 cut(s)	313, 394
HindII	GTYRAC	2 cut(s)	313, 394
HinfI	GANTC	3 cut(s)	116, 886, 1020
HphI	GGTGA	5 cut(s)	4, 139, 280, 583, 1088
Hpy166II	GTNNAC	3 cut(s)	313, 394, 451
Hpy188I	TCNGA	3 cut(s)	414, 921, 1116
Hpy188III	TCNNGA	6 cut(s)	52, 100, 373, 653, 662, 875
Hpy8I	GTNNAC	3 cut(s)	313, 394, 451
Hpy99I	CGWCG	9 cut(s)	140, 143, 161, 278, 281, 308, 314, 374, 428
HpyAV	CCTTC	3 cut(s)	370, 659, 919
HpyCH4III	ACNGT	1 cut(s)	956
HpyCH4IV	ACGT	4 cut(s)	273, 426, 577, 593
HpyCH4V	TGCA	5 cut(s)	418, 831, 959, 1010, 1100
HpyF3I	CTNAG	3 cut(s)	567, 861, 1122
HpySE526I	ACGT	4 cut(s)	273, 426, 577, 593
Hsp92I	GRCGYC	4 cut(s)	42, 144, 153, 309
Hsp92II	CATG	3 cut(s)	656, 831, 860
HspAI	GCGC	5 cut(s)	42, 153, 232, 330, 497
KasI	GGCGCC	2 cut(s)	41, 152
Kpn2I	TCCGGA	1 cut(s)	99
KroI	GCCGGC	1 cut(s)	239
KroNI	GCCGGC	1 cut(s)	241
Ksp22I	TGATCA	1 cut(s)	1078
Kzo9I	GATC	2 cut(s)	471, 1078
LmnI	GCTCC	8 cut(s)	212, 239, 267, 283, 524, 611, 934, 1094
Lsp1109I	GCAGC	8 cut(s)	309, 529, 589, 607, 610, 655, 971, 1084
LweI	GCATC	3 cut(s)	45, 57, 405
MaeI	CTAG	2 cut(s)	606, 773
MaeII	ACGT	4 cut(s)	273, 426, 577, 593
MaeIII	GTNAC	4 cut(s)	145, 560, 676, 817
MalI	GATC	2 cut(s)	473, 1080
MbiI	CCGCTC	1 cut(s)	207
MboI	GATC	2 cut(s)	471, 1078
MboII	GAAGA	5 cut(s)	25, 316, 731, 770, 934
MhlI	GDGCHC	4 cut(s)	288, 363, 383, 856
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	5 cut(s)	514, 712, 727, 878, 967
MluNI	TGGCCA	1 cut(s)	5
Mly113I	GGCGCC	2 cut(s)	42, 153
MlyI	GAGTC	1 cut(s)	110
MmeI	TCCRAC	1 cut(s)	1038
Mox20I	TGGCCA	1 cut(s)	5
Mph1103I	ATGCAT	1 cut(s)	833
MroI	TCCGGA	1 cut(s)	99
MroNI	GCCGGC	1 cut(s)	239
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	2 cut(s)	711, 1104
MslI	CAYNNNNRTG	2 cut(s)	53, 215
Msp20I	TGGCCA	1 cut(s)	5
MspA1I	CMGCKG	2 cut(s)	697, 734
MspR9I	CCNGG	6 cut(s)	76, 113, 164, 260, 455, 933
MvaI	CCWGG	4 cut(s)	113, 164, 260, 933
MvnI	CGCG	2 cut(s)	96, 192
NaeI	GCCGGC	1 cut(s)	241
NarI	GGCGCC	2 cut(s)	42, 153
NciI	CCSGG	2 cut(s)	76, 455
NdeII	GATC	2 cut(s)	471, 1078
NgoMIV	GCCGGC	1 cut(s)	239
NlaIII	CATG	3 cut(s)	656, 831, 860
NlaIV	GGNNCC	6 cut(s)	43, 154, 340, 361, 382, 930
NmeAIII	GCCGAG	1 cut(s)	383
NmuCI	GTSAC	2 cut(s)	145, 560
NsiI	ATGCAT	1 cut(s)	833
NspI	RCATGY	2 cut(s)	831, 860
PagI	TCATGA	1 cut(s)	652
PcsI	WCGNNNNNNNCGW	1 cut(s)	309
PdiI	GCCGGC	1 cut(s)	241
PfeI	GAWTC	2 cut(s)	886, 1020
PflFI	GACNNNGTC	1 cut(s)	308
PfoI	TCCNGGA	2 cut(s)	74, 111
PleI	GAGTC	1 cut(s)	110
PluTI	GGCGCC	2 cut(s)	45, 156
PpsI	GAGTC	1 cut(s)	110
Ppu21I	YACGTR	1 cut(s)	594
Psp124BI	GAGCTC	1 cut(s)	288
Psp6I	CCWGG	4 cut(s)	111, 162, 258, 931
PspGI	CCWGG	4 cut(s)	111, 162, 258, 931
PspN4I	GGNNCC	6 cut(s)	43, 154, 340, 361, 382, 930
PspOMI	GGGCCC	1 cut(s)	359
PspPI	GGNCC	6 cut(s)	106, 122, 262, 339, 359, 360
PsyI	GACNNNGTC	1 cut(s)	308
RseI	CAYNNNNRTG	2 cut(s)	53, 215
SacI	GAGCTC	1 cut(s)	288
SalI	GTCGAC	1 cut(s)	311
SaqAI	TTAA	2 cut(s)	711, 1104
Sau3AI	GATC	2 cut(s)	471, 1078
Sau96I	GGNCC	6 cut(s)	106, 122, 262, 339, 359, 360
SchI	GAGTC	1 cut(s)	110
ScrFI	CCNGG	6 cut(s)	76, 113, 164, 260, 455, 933
SduI	GDGCHC	4 cut(s)	288, 363, 383, 856
SfaNI	GCATC	3 cut(s)	45, 57, 405
SfcI	CTRYAG	1 cut(s)	1133
SfoI	GGCGCC	2 cut(s)	43, 154
SgrAI	CRCCGGYG	2 cut(s)	149, 290
SinI	GGWCC	1 cut(s)	339
SmiMI	CAYNNNNRTG	2 cut(s)	53, 215
SmlI	CTYRAG	1 cut(s)	638
SmoI	CTYRAG	1 cut(s)	638
SpeI	ACTAGT	1 cut(s)	772
Sse9I	AATT	5 cut(s)	514, 712, 727, 878, 967
SspDI	GGCGCC	2 cut(s)	41, 152
SspMI	CTAG	2 cut(s)	606, 773
SstI	GAGCTC	1 cut(s)	288
StyD4I	CCNGG	6 cut(s)	74, 111, 162, 258, 453, 931
TaaI	ACNGT	1 cut(s)	956
TaiI	ACGT	4 cut(s)	276, 429, 580, 596
TaqI	TCGA	4 cut(s)	279, 303, 312, 372
TasI	AATT	5 cut(s)	514, 712, 727, 878, 967
TauI	GCSGC	3 cut(s)	42, 297, 700
TfiI	GAWTC	2 cut(s)	886, 1020
Tru1I	TTAA	2 cut(s)	711, 1104
Tru9I	TTAA	2 cut(s)	711, 1104
TseFI	GTSAC	2 cut(s)	145, 560
TseI	GCWGC	8 cut(s)	297, 542, 602, 620, 623, 643, 959, 1097
Tsp45I	GTSAC	2 cut(s)	145, 560
TspDTI	ATGAA	2 cut(s)	771, 782
TspGWI	ACGGA	1 cut(s)	166
Tth111I	GACNNNGTC	1 cut(s)	308
VpaK11BI	GGWCC	1 cut(s)	339
XagI	CCTNNNNNAGG	1 cut(s)	896
XapI	RAATTY	1 cut(s)	878
XceI	RCATGY	2 cut(s)	831, 860
XmiI	GTMKAC	1 cut(s)	312
XspI	CTAG	2 cut(s)	606, 773
Zsp2I	ATGCAT	1 cut(s)	833

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.