MD12G1059800.v1.1

resistance protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Forward (+)
6966488 .. 6968282
1795 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1059800.v1.1.491

Sequence Viewer

Length: 207 bp
ATGAACAAGTTGCTTTTCCAGCAAGGAAGTGATGATCGGTTCAGGGAAGTAGGCATTGTTGGTGATGATAGTATAGGAAAAACAACACTTTTCCAGCTCTTATTCGACAAACAAGAAGTGAAAAACACATTCCTCCCAACAGGTATCCCCTGTGGTAACAAGTCAATGTGGCAACAGATAGGAGCACATTCGACGTCGTTAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.62

Weight (kDa)

5.68

Isoelectric Point (pI)

18.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009951)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 197
AcyI GRCGYC 1 cut(s) 194
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
Alw21I GWGCWC 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 74
Bbv12I GWGCWC 1 cut(s) 187
BciVI GTATCC 1 cut(s) 155
BfuI GTATCC 1 cut(s) 155
BsaHI GRCGYC 1 cut(s) 194
BsiHKAI GWGCWC 1 cut(s) 187
Bsp1286I GDGCHC 1 cut(s) 187
Bsp143I GATC 1 cut(s) 34
BssMI GATC 1 cut(s) 34
BssNI GRCGYC 1 cut(s) 194
BstACI GRCGYC 1 cut(s) 194
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 19
BsuI GTATCC 1 cut(s) 155
CviJI RGCY 1 cut(s) 97
CviKI_1 RGCY 1 cut(s) 97
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
FaiI YATR 1 cut(s) 74
Hin1I GRCGYC 1 cut(s) 194
HphI GGTGA 1 cut(s) 74
Hpy99I CGWCG 2 cut(s) 196, 199
HpyCH4IV ACGT 1 cut(s) 194
HpyF10VI GCNNNNNNNGC 1 cut(s) 19
HpySE526I ACGT 1 cut(s) 194
Hsp92I GRCGYC 1 cut(s) 194
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 182
LpnPI CCDG 5 cut(s) 28, 32, 107, 126, 163
MaeII ACGT 1 cut(s) 194
MaeIII GTNAC 1 cut(s) 155
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MhlI GDGCHC 1 cut(s) 187
MnlI CCTC 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 19
NdeII GATC 1 cut(s) 34
Sau3AI GATC 1 cut(s) 34
SduI GDGCHC 1 cut(s) 187
SetI ASST 3 cut(s) 99, 145, 197
SgeI CNNG 9 cut(s) 19, 31, 35, 55, 106, 125, 153, 162, 172
TaiI ACGT 1 cut(s) 197
TaqI TCGA 2 cut(s) 105, 191
TspDTI ATGAA 1 cut(s) 17
ZraI GACGTC 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.