Prupe.2G018200_v2.0.a1

Cytosolic domain of 10TM putative phosphate transporter

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
OG0000893
Physical Location & Seq
Reverse (-)
1706515 .. 1709078
2564 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G018200.1

Sequence Viewer

Length: 300 bp
ATGAAAGCAGGCCTCCAATTAAGCTTGAGTGTGAGAGTATTTGGCTTTGCTGGGATTGTTGAGGCTGTCATTCTTCTTCCAATAAATTATCTGGGAAGCCAGCTCTCCTTCAGTATTTCAAATGTCAATGATGGCTCAAAATGCTCTAGGGAAGAGAAGGGCTTTTACAACAGGAACAGGAAAGATCACTTGGAATCAATTGGGAAGAAGTGGCATGCAATGGTGTGGTACACATGCCAGATATGCATGGAACTCTGTAACAATGAAGGAAAAAGAAGAAACATTAAGCCAAATACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PHM7_cyt RSN1_7TM RSN1_TM

Protein Analysis

100

Amino Acids

11.25

Weight (kDa)

9.39

Isoelectric Point (pI)

42.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 94
AfaI GTAC 1 cut(s) 230
AgsI TTSAA 1 cut(s) 120
AjuI GAANNNNNNNTTGG 2 cut(s) 173, 205
AluBI AGCT 2 cut(s) 24, 103
AluI AGCT 2 cut(s) 24, 103
AoxI GGCC 1 cut(s) 10
BarI GAAGNNNNNNTAC 2 cut(s) 149, 181
BccI CCATC 1 cut(s) 125
BfaI CTAG 1 cut(s) 147
BpuEI CTTGAG 1 cut(s) 46
Bse3DI GCAATG 1 cut(s) 225
BseMI GCAATG 1 cut(s) 225
BseYI CCCAGC 1 cut(s) 50
BshFI GGCC 1 cut(s) 12
BsnI GGCC 1 cut(s) 12
Bsp143I GATC 1 cut(s) 184
BspANI GGCC 1 cut(s) 12
BsrDI GCAATG 1 cut(s) 225
BssMI GATC 1 cut(s) 184
Bst6I CTCTTC 1 cut(s) 147
BstC8I GCNNGC 3 cut(s) 10, 101, 216
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BstMWI GCNNNNNNNGC 2 cut(s) 141, 243
BstNSI RCATGY 2 cut(s) 218, 237
BsuRI GGCC 1 cut(s) 12
Cac8I GCNNGC 3 cut(s) 10, 101, 216
Csp6I GTAC 1 cut(s) 229
CviAII CATG 4 cut(s) 215, 234, 247, 297
CviJI RGCY 9 cut(s) 12, 24, 45, 65, 99, 103, 135, 162, 289
CviKI_1 RGCY 9 cut(s) 12, 24, 45, 65, 99, 103, 135, 162, 289
CviQI GTAC 1 cut(s) 229
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
Eam1104I CTCTTC 1 cut(s) 147
EarI CTCTTC 1 cut(s) 147
Eco147I AGGCCT 1 cut(s) 12
Eco57I CTGAAG 1 cut(s) 94
EcoT22I ATGCAT 1 cut(s) 248
FaeI CATG 4 cut(s) 218, 237, 250, 300
FaiI YATR 5 cut(s) 216, 235, 244, 248, 298
FatI CATG 4 cut(s) 214, 233, 246, 296
FspBI CTAG 1 cut(s) 147
GsaI CCCAGC 1 cut(s) 54
HaeIII GGCC 1 cut(s) 12
Hin1II CATG 4 cut(s) 218, 237, 250, 300
HindIII AAGCTT 1 cut(s) 22
HinfI GANTC 1 cut(s) 194
Hpy166II GTNNAC 1 cut(s) 231
Hpy8I GTNNAC 1 cut(s) 231
HpyAV CCTTC 3 cut(s) 118, 151, 260
HpyCH4V TGCA 2 cut(s) 218, 246
HpyF10VI GCNNNNNNNGC 2 cut(s) 141, 243
Hsp92II CATG 4 cut(s) 218, 237, 250, 300
Kzo9I GATC 1 cut(s) 184
LpnPI CCDG 6 cut(s) 36, 77, 113, 157, 163, 251
MaeI CTAG 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 257
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MboII GAAGA 5 cut(s) 65, 68, 164, 217, 288
MfeI CAATTG 1 cut(s) 198
MluCI AATT 3 cut(s) 17, 85, 198
MnlI CCTC 2 cut(s) 23, 55
Mph1103I ATGCAT 1 cut(s) 248
MseI TTAA 2 cut(s) 20, 285
MunI CAATTG 1 cut(s) 198
MwoI GCNNNNNNNGC 2 cut(s) 141, 243
NdeII GATC 1 cut(s) 184
NlaIII CATG 4 cut(s) 218, 237, 250, 300
NsiI ATGCAT 1 cut(s) 248
NspI RCATGY 2 cut(s) 218, 237
PaeI GCATGC 1 cut(s) 218
PceI AGGCCT 1 cut(s) 12
PfeI GAWTC 1 cut(s) 194
PspFI CCCAGC 1 cut(s) 50
RsaI GTAC 1 cut(s) 230
RsaNI GTAC 1 cut(s) 229
SaqAI TTAA 2 cut(s) 20, 285
Sau3AI GATC 1 cut(s) 184
SetI ASST 2 cut(s) 26, 105
SmlI CTYRAG 1 cut(s) 25
SmoI CTYRAG 1 cut(s) 25
SphI GCATGC 1 cut(s) 218
Sse9I AATT 3 cut(s) 17, 85, 198
SseBI AGGCCT 1 cut(s) 12
SspMI CTAG 1 cut(s) 147
StuI AGGCCT 1 cut(s) 12
TasI AATT 3 cut(s) 17, 85, 198
TfiI GAWTC 1 cut(s) 194
Tru1I TTAA 2 cut(s) 20, 285
Tru9I TTAA 2 cut(s) 20, 285
TspDTI ATGAA 2 cut(s) 17, 279
XceI RCATGY 2 cut(s) 218, 237
XspI CTAG 1 cut(s) 147
Zsp2I ATGCAT 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.