Prupe.7G230800_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0005077
Physical Location & Seq
Reverse (-)
20239276 .. 20239849
574 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G230800.1

Sequence Viewer

Length: 420 bp
ATGGCGTCGAGCTGCCTCTCAACGCTGGGTAGTGTACCTCCTTCTTGGAGTGGTTGGTCGAGTTGGAGAAAGCAATTTCCTTTAGCCTCAGCAAGCTCGTCATCTTCATCCTCTGCTTCATGGTTCGATTCTCGACGGCTTCGGAGGACCCAGGTGGTGTGTATGGCCCCAGATGAGGAGAAACTCACTCGCCGCAACCCTCTCGATTTCCCAATTGAGTGGGAGAGGCCTAAGCCAGGGCGTAGACCTGACATCTTCCCCCAGTTCAGTCCTATGAAAACACCTTTGCCACCTCCAATGCCATATGACCCTCCCGAAGAAGACGAAGACGAGGAGGAGAAGAAGGAGGAAGAAGAAGAGGAGCAAGAGCAAGAGGAGGAATCTCCTGAGAAGATTGACCCAGATAAGAACAATATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

16.05

Weight (kDa)

4.52

Isoelectric Point (pI)

119.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 244
AciI CCGC 1 cut(s) 193
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 1 cut(s) 36
AfiI CCNNNNNNNGG 2 cut(s) 175, 236
AjnI CCWGG 2 cut(s) 150, 235
AluBI AGCT 2 cut(s) 12, 96
AluI AGCT 2 cut(s) 12, 96
AoxI GGCC 2 cut(s) 165, 227
ApeKI GCWGC 1 cut(s) 12
AspS9I GGNCC 2 cut(s) 147, 166
AvaII GGWCC 1 cut(s) 147
BbsI GAAGAC 2 cut(s) 327, 333
BbvCI CCTCAGC 1 cut(s) 88
BceAI ACGGC 1 cut(s) 152
BcgI CGANNNNNNTGC 2 cut(s) 184, 218
BciT130I CCWGG 2 cut(s) 152, 237
BisI GCNGC 2 cut(s) 13, 193
BlsI GCNGC 2 cut(s) 14, 194
Bme1390I CCNGG 2 cut(s) 152, 237
Bme18I GGWCC 1 cut(s) 147
BmgT120I GGNCC 2 cut(s) 147, 166
BmiI GGNNCC 2 cut(s) 149, 168
BmrFI CCNGG 2 cut(s) 152, 237
BmrI ACTGGG 1 cut(s) 256
BmuI ACTGGG 1 cut(s) 256
BpiI GAAGAC 2 cut(s) 327, 333
Bpu10I CCTNAGC 2 cut(s) 88, 231
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 2 cut(s) 150, 236
Bsc4I CCNNNNNNNGG 2 cut(s) 175, 236
Bse1I ACTGG 1 cut(s) 262
BseBI CCWGG 2 cut(s) 152, 237
BseDI CCNNGG 2 cut(s) 150, 236
BseGI GGATG 1 cut(s) 107
BseLI CCNNNNNNNGG 2 cut(s) 175, 236
BseMII CTCAG 2 cut(s) 102, 378
BseNI ACTGG 1 cut(s) 262
BseRI GAGGAG 5 cut(s) 191, 347, 350, 374, 389
BseYI CCCAGC 1 cut(s) 25
BshFI GGCC 2 cut(s) 167, 229
BslI CCNNNNNNNGG 2 cut(s) 175, 236
BsnI GGCC 2 cut(s) 167, 229
BspACI CCGC 1 cut(s) 193
BspANI GGCC 2 cut(s) 167, 229
BspCNI CTCAG 2 cut(s) 101, 379
BspLI GGNNCC 2 cut(s) 149, 168
BsrI ACTGG 1 cut(s) 262
BssECI CCNNGG 2 cut(s) 150, 236
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 2 cut(s) 152, 237
Bst6I CTCTTC 1 cut(s) 351
BstACI GRCGYC 1 cut(s) 5
BstC8I GCNNGC 1 cut(s) 94
BstDEI CTNAG 3 cut(s) 88, 231, 387
BstENI CCTNNNNNAGG 1 cut(s) 234
BstF5I GGATG 1 cut(s) 107
BstNI CCWGG 2 cut(s) 152, 237
BstSCI CCNGG 2 cut(s) 150, 235
BstV2I GAAGAC 2 cut(s) 327, 333
BstXI CCANNNNNNTGG 1 cut(s) 219
BsuRI GGCC 2 cut(s) 167, 229
BtsCI GGATG 1 cut(s) 107
Cac8I GCNNGC 1 cut(s) 94
Cfr13I GGNCC 2 cut(s) 147, 166
Csp6I GTAC 1 cut(s) 35
CviAII CATG 1 cut(s) 120
CviJI RGCY 7 cut(s) 12, 86, 96, 139, 167, 229, 235
CviKI_1 RGCY 7 cut(s) 12, 86, 96, 139, 167, 229, 235
CviQI GTAC 1 cut(s) 35
DdeI CTNAG 3 cut(s) 88, 231, 387
Eam1104I CTCTTC 1 cut(s) 351
EarI CTCTTC 1 cut(s) 351
Eco147I AGGCCT 1 cut(s) 229
Eco47I GGWCC 1 cut(s) 147
EcoNI CCTNNNNNAGG 1 cut(s) 234
EcoO109I RGGNCCY 1 cut(s) 147
EcoRII CCWGG 2 cut(s) 150, 235
FaeI CATG 1 cut(s) 123
FaiI YATR 5 cut(s) 121, 164, 275, 304, 306
FatI CATG 1 cut(s) 119
FauNDI CATATG 1 cut(s) 304
FblI GTMKAC 1 cut(s) 244
Fnu4HI GCNGC 2 cut(s) 13, 193
FokI GGATG 1 cut(s) 94
Fsp4HI GCNGC 2 cut(s) 13, 193
GluI GCNGC 2 cut(s) 13, 193
GsaI CCCAGC 1 cut(s) 29
HaeIII GGCC 2 cut(s) 167, 229
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 1 cut(s) 123
HinfI GANTC 2 cut(s) 128, 380
Hpy166II GTNNAC 2 cut(s) 35, 245
Hpy188I TCNGA 1 cut(s) 144
Hpy188III TCNNGA 4 cut(s) 132, 203, 314, 386
Hpy8I GTNNAC 2 cut(s) 35, 245
Hpy99I CGWCG 2 cut(s) 10, 138
HpyAV CCTTC 2 cut(s) 51, 337
HpyF3I CTNAG 3 cut(s) 88, 231, 387
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 1 cut(s) 123
LmnI GCTCC 1 cut(s) 361
MfeI CAATTG 1 cut(s) 213
MluCI AATT 2 cut(s) 74, 213
MmeI TCCRAC 1 cut(s) 44
MseI TTAA 1 cut(s) 418
MspR9I CCNGG 2 cut(s) 152, 237
MunI CAATTG 1 cut(s) 213
MvaI CCWGG 2 cut(s) 152, 237
NdeI CATATG 1 cut(s) 304
NlaIII CATG 1 cut(s) 123
NlaIV GGNNCC 2 cut(s) 149, 168
PceI AGGCCT 1 cut(s) 229
PfeI GAWTC 2 cut(s) 128, 380
PkrI GCNGC 2 cut(s) 14, 194
PpuMI RGGWCCY 1 cut(s) 147
Psp5II RGGWCCY 1 cut(s) 147
Psp6I CCWGG 2 cut(s) 150, 235
PspFI CCCAGC 1 cut(s) 25
PspGI CCWGG 2 cut(s) 150, 235
PspN4I GGNNCC 2 cut(s) 149, 168
PspPI GGNCC 2 cut(s) 147, 166
PspPPI RGGWCCY 1 cut(s) 147
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
SaqAI TTAA 1 cut(s) 418
SatI GCNGC 2 cut(s) 13, 193
Sau96I GGNCC 2 cut(s) 147, 166
ScrFI CCNGG 2 cut(s) 152, 237
SetI ASST 7 cut(s) 14, 40, 98, 156, 250, 286, 295
SinI GGWCC 1 cut(s) 147
Sse9I AATT 2 cut(s) 74, 213
SseBI AGGCCT 1 cut(s) 229
SsiI CCGC 1 cut(s) 193
SspI AATATT 1 cut(s) 415
StuI AGGCCT 1 cut(s) 229
StyD4I CCNGG 2 cut(s) 150, 235
TaqI TCGA 5 cut(s) 8, 59, 126, 133, 204
TasI AATT 2 cut(s) 74, 213
TauI GCSGC 1 cut(s) 195
TfiI GAWTC 2 cut(s) 128, 380
Tru1I TTAA 1 cut(s) 418
Tru9I TTAA 1 cut(s) 418
TseI GCWGC 1 cut(s) 12
TspDTI ATGAA 3 cut(s) 96, 108, 290
VpaK11BI GGWCC 1 cut(s) 147
XagI CCTNNNNNAGG 1 cut(s) 234
XmiI GTMKAC 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.