Rh2BG409900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0005077
Physical Location & Seq
Forward (+)
58046386 .. 58050547
4162 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG409900.1

Sequence Viewer

Length: 417 bp
ATGGCGTTGCGGAGCCTGACGGTGCCTCTGCCCGCCGTAATTCCACCAGTCTCCTCTTCTTCTTATAGTCTTACACAAAACAACCACTACAATTCCCCTTGCTATGTAACTCTCCTCCGCACCCCTACCGTCGTCGTTCACAGCCTTCGGATGCGACGGCATGTCGTTCGGATGGCTCCCGAGGAGGAAAGGTTGACCCGTCGCTCCCCTCTGGATTTCCCCATCGAATGGGAAAGACCAAAACCTGGGAGGAGACCAGATATATTTCCCCAGTTTAGCCCTATGAAAACACCTTTACCAACTCCAATGCCAGCAGATCCTCCCGAAGATGATGAAGAAGAGGAAGAAAAGAAAGAGGATGACGAAGAAGGAGAAGACAATCCTGACAAGGAGAACCCAGGAATCCCAGAAGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

15.85

Weight (kDa)

4.82

Isoelectric Point (pI)

95.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 22
AccB7I CCANNNNNTGG 2 cut(s) 228, 245
AciI CCGC 3 cut(s) 10, 33, 118
AclWI GGATC 1 cut(s) 311
AfiI CCNNNNNNNGG 2 cut(s) 228, 245
AhdI GACNNNNNGTC 1 cut(s) 161
AjnI CCWGG 2 cut(s) 244, 397
Alw26I GTCTC 2 cut(s) 55, 247
AlwI GGATC 1 cut(s) 311
Ama87I CYCGRG 1 cut(s) 179
AvaI CYCGRG 1 cut(s) 179
BanI GGYRCC 1 cut(s) 22
BbsI GAAGAC 1 cut(s) 381
BccI CCATC 2 cut(s) 166, 230
BceAI ACGGC 2 cut(s) 20, 173
BcgI CGANNNNNNTGC 2 cut(s) 149, 183
BciT130I CCWGG 2 cut(s) 246, 399
BcoDI GTCTC 2 cut(s) 55, 247
Bme1390I CCNGG 2 cut(s) 246, 399
BmeRI GACNNNNNGTC 1 cut(s) 161
BmeT110I CYCGRG 1 cut(s) 179
BmiI GGNNCC 3 cut(s) 14, 24, 177
BmrFI CCNGG 2 cut(s) 246, 399
BmrI ACTGGG 1 cut(s) 265
BmsI GCATC 1 cut(s) 141
BmuI ACTGGG 1 cut(s) 265
BpiI GAAGAC 1 cut(s) 381
BsaI GGTCTC 1 cut(s) 247
BsaJI CCNNGG 3 cut(s) 180, 245, 397
BsaXI ACNNNNNCTCC 2 cut(s) 176, 206
Bsc4I CCNNNNNNNGG 2 cut(s) 228, 245
Bse1I ACTGG 2 cut(s) 47, 271
BseBI CCWGG 2 cut(s) 246, 399
BseDI CCNNGG 3 cut(s) 180, 245, 397
BseGI GGATG 3 cut(s) 156, 177, 364
BseLI CCNNNNNNNGG 2 cut(s) 228, 245
BseNI ACTGG 2 cut(s) 47, 271
BseRI GAGGAG 4 cut(s) 43, 104, 197, 265
BshNI GGYRCC 1 cut(s) 22
BsiHKCI CYCGRG 1 cut(s) 179
BslI CCNNNNNNNGG 2 cut(s) 228, 245
BsmAI GTCTC 2 cut(s) 55, 247
Bso31I GGTCTC 1 cut(s) 247
BsoBI CYCGRG 1 cut(s) 179
Bsp143I GATC 1 cut(s) 316
BspACI CCGC 3 cut(s) 10, 33, 118
BspLI GGNNCC 3 cut(s) 14, 24, 177
BspPI GGATC 1 cut(s) 311
BspT107I GGYRCC 1 cut(s) 22
BspTNI GGTCTC 1 cut(s) 247
BsrI ACTGG 2 cut(s) 47, 271
BssECI CCNNGG 3 cut(s) 180, 245, 397
BssMI GATC 1 cut(s) 316
Bst2UI CCWGG 2 cut(s) 246, 399
Bst4CI ACNGT 2 cut(s) 22, 130
Bst6I CTCTTC 3 cut(s) 61, 333, 405
BstC8I GCNNGC 2 cut(s) 33, 312
BstF5I GGATG 3 cut(s) 156, 177, 364
BstKTI GATC 1 cut(s) 319
BstMAI GTCTC 2 cut(s) 55, 247
BstMBI GATC 1 cut(s) 316
BstNI CCWGG 2 cut(s) 246, 399
BstNSI RCATGY 1 cut(s) 164
BstSCI CCNGG 2 cut(s) 244, 397
BstV2I GAAGAC 1 cut(s) 381
BstX2I RGATCY 1 cut(s) 316
BstYI RGATCY 1 cut(s) 316
BtsCI GGATG 3 cut(s) 156, 177, 364
Cac8I GCNNGC 2 cut(s) 33, 312
CviAII CATG 1 cut(s) 161
CviJI RGCY 4 cut(s) 15, 144, 176, 279
CviKI_1 RGCY 4 cut(s) 15, 144, 176, 279
DpnI GATC 1 cut(s) 318
DpnII GATC 1 cut(s) 316
DriI GACNNNNNGTC 1 cut(s) 161
Eam1104I CTCTTC 3 cut(s) 61, 333, 405
Eam1105I GACNNNNNGTC 1 cut(s) 161
EarI CTCTTC 3 cut(s) 61, 333, 405
Eco31I GGTCTC 1 cut(s) 247
Eco88I CYCGRG 1 cut(s) 179
EcoRII CCWGG 2 cut(s) 244, 397
FaeI CATG 1 cut(s) 164
FaiI YATR 5 cut(s) 66, 105, 162, 263, 284
FatI CATG 1 cut(s) 160
FauI CCCGC 1 cut(s) 40
FokI GGATG 3 cut(s) 163, 184, 371
Hin1II CATG 1 cut(s) 164
HincII GTYRAC 1 cut(s) 195
HindII GTYRAC 1 cut(s) 195
HinfI GANTC 1 cut(s) 402
Hpy166II GTNNAC 2 cut(s) 139, 195
Hpy188I TCNGA 2 cut(s) 150, 171
Hpy188III TCNNGA 4 cut(s) 179, 212, 323, 383
Hpy8I GTNNAC 2 cut(s) 139, 195
Hpy99I CGWCG 4 cut(s) 134, 137, 159, 204
HpyAV CCTTC 2 cut(s) 155, 362
HpyCH4III ACNGT 2 cut(s) 22, 130
Hsp92II CATG 1 cut(s) 164
Kzo9I GATC 1 cut(s) 316
LmnI GCTCC 3 cut(s) 12, 181, 209
LweI GCATC 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 106
MalI GATC 1 cut(s) 318
MboI GATC 1 cut(s) 316
MboII GAAGA 8 cut(s) 48, 51, 338, 347, 350, 356, 377, 386
MflI RGATCY 1 cut(s) 316
MluCI AATT 2 cut(s) 39, 91
MspR9I CCNGG 2 cut(s) 246, 399
MvaI CCWGG 2 cut(s) 246, 399
NdeII GATC 1 cut(s) 316
NlaIII CATG 1 cut(s) 164
NlaIV GGNNCC 3 cut(s) 14, 24, 177
NspI RCATGY 1 cut(s) 164
PfeI GAWTC 1 cut(s) 402
PflMI CCANNNNNTGG 2 cut(s) 228, 245
Psp6I CCWGG 2 cut(s) 244, 397
PspGI CCWGG 2 cut(s) 244, 397
PspN4I GGNNCC 3 cut(s) 14, 24, 177
PsuI RGATCY 1 cut(s) 316
Sau3AI GATC 1 cut(s) 316
ScrFI CCNGG 2 cut(s) 246, 399
SetI ASST 3 cut(s) 194, 247, 295
SfaNI GCATC 1 cut(s) 141
Sse9I AATT 2 cut(s) 39, 91
SsiI CCGC 3 cut(s) 10, 33, 118
StyD4I CCNGG 2 cut(s) 244, 397
TaaI ACNGT 2 cut(s) 22, 130
TaqI TCGA 1 cut(s) 225
TasI AATT 2 cut(s) 39, 91
TfiI GAWTC 1 cut(s) 402
TspDTI ATGAA 2 cut(s) 299, 348
Van91I CCANNNNNTGG 2 cut(s) 228, 245
XceI RCATGY 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.