pycom03g06390

Ring finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0002401
Physical Location & Seq
Forward (+)
4985000 .. 4985343
344 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g06390.2

Sequence Viewer

Length: 225 bp
ATGGGATGGTGCCGGATATGTAAAGTTGATTGTGAAACAGTTGAAGGTTTGGACTTGCATTCACAAACAAGGGAACACCAGAAGATGGCTATGGATATGGTGCGAACCATCAAGCAAAATGCCAAAAAGCAGAAACTAACCTCTGGTGATCAGTCCGTGGTAGAGGATGAAAATAAGTCAAAAAATCCAGCTTTGAAGCCCGGGGAGAAAAGCATTGATGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.33

Weight (kDa)

7.72

Isoelectric Point (pI)

30.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 9
AccB7I CCANNNNNTGG 1 cut(s) 85
AfiI CCNNNNNNNGG 1 cut(s) 85
AgsI TTSAA 2 cut(s) 44, 196
AluBI AGCT 1 cut(s) 191
AluI AGCT 1 cut(s) 191
Ama87I CYCGRG 1 cut(s) 200
AsuC2I CCSGG 2 cut(s) 201, 202
AsuHPI GGTGA 1 cut(s) 158
AvaI CYCGRG 1 cut(s) 200
BanI GGYRCC 1 cut(s) 9
BccI CCATC 3 cut(s) 79, 116, 212
BclI TGATCA 1 cut(s) 148
BcnI CCSGG 2 cut(s) 201, 202
Bme1390I CCNGG 2 cut(s) 201, 202
BmeT110I CYCGRG 1 cut(s) 200
BmiI GGNNCC 1 cut(s) 11
BmrFI CCNGG 2 cut(s) 201, 202
BpuMI CCSGG 2 cut(s) 201, 202
BsaJI CCNNGG 3 cut(s) 156, 200, 201
Bsc4I CCNNNNNNNGG 1 cut(s) 85
BseDI CCNNGG 3 cut(s) 156, 200, 201
BseGI GGATG 2 cut(s) 11, 172
BseLI CCNNNNNNNGG 1 cut(s) 85
BshNI GGYRCC 1 cut(s) 9
BsiHKCI CYCGRG 1 cut(s) 200
BsiSI CCGG 2 cut(s) 13, 201
BslI CCNNNNNNNGG 1 cut(s) 85
BsmI GAATGC 1 cut(s) 58
BsoBI CYCGRG 1 cut(s) 200
Bsp143I GATC 1 cut(s) 148
BspLI GGNNCC 1 cut(s) 11
BspT107I GGYRCC 1 cut(s) 9
BssECI CCNNGG 3 cut(s) 156, 200, 201
BssMI GATC 1 cut(s) 148
Bst4CI ACNGT 1 cut(s) 40
BstDSI CCRYGG 1 cut(s) 156
BstF5I GGATG 2 cut(s) 11, 172
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstSCI CCNGG 2 cut(s) 199, 200
BtgI CCRYGG 1 cut(s) 156
BtsCI GGATG 2 cut(s) 11, 172
Cfr9I CCCGGG 1 cut(s) 200
CviJI RGCY 3 cut(s) 89, 191, 199
CviKI_1 RGCY 3 cut(s) 89, 191, 199
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
Eco88I CYCGRG 1 cut(s) 200
FaiI YATR 3 cut(s) 19, 92, 98
FbaI TGATCA 1 cut(s) 148
FokI GGATG 2 cut(s) 18, 179
HapII CCGG 2 cut(s) 13, 201
HpaII CCGG 2 cut(s) 13, 201
HphI GGTGA 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 38
HpyCH4III ACNGT 1 cut(s) 40
HpyCH4V TGCA 1 cut(s) 58
Ksp22I TGATCA 1 cut(s) 148
Kzo9I GATC 1 cut(s) 148
LpnPI CCDG 5 cut(s) 26, 92, 129, 201, 214
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MboII GAAGA 1 cut(s) 94
MnlI CCTC 2 cut(s) 151, 157
MspI CCGG 2 cut(s) 13, 201
MspR9I CCNGG 2 cut(s) 201, 202
Mva1269I GAATGC 1 cut(s) 58
NciI CCSGG 2 cut(s) 201, 202
NdeII GATC 1 cut(s) 148
NlaIV GGNNCC 1 cut(s) 11
PctI GAATGC 1 cut(s) 58
PflMI CCANNNNNTGG 1 cut(s) 85
PspN4I GGNNCC 1 cut(s) 11
Sau3AI GATC 1 cut(s) 148
ScrFI CCNGG 2 cut(s) 201, 202
SetI ASST 3 cut(s) 49, 143, 193
SmaI CCCGGG 1 cut(s) 202
StyD4I CCNGG 2 cut(s) 199, 200
TaaI ACNGT 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 183
TspGWI ACGGA 1 cut(s) 145
TspMI CCCGGG 1 cut(s) 200
Van91I CCANNNNNTGG 1 cut(s) 85
XmaI CCCGGG 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.