pycom07g22650

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
23890499 .. 23890878
380 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g22650.2

Sequence Viewer

Length: 267 bp
ATGAACTGTTCTTGGCTGACATCCGCATCTGTTGCATATAAGCGCGACTCCTCTTCATGGACACGCCTTGCGCCTGCAAAAGTTATTGACTCTTCTAGTTTGCAAAAATGGGAAGAGGTTCTTGATATGTTCAACGACCTCATTGATTGGTTGAAAAACGAAAGGGAGTTACTCGTTTCCGTAGCAAAGTTTGAGGTCATGAAAGAGAGGCTGTCACAAGAGGATGTGCAGATGGATAGAAGTGGATGTACGAGATGGGGTTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.25

Weight (kDa)

5.07

Isoelectric Point (pI)

57.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 45
AciI CCGC 1 cut(s) 24
AfaI GTAC 1 cut(s) 250
AfiI CCNNNNNNNGG 1 cut(s) 57
AgsI TTSAA 2 cut(s) 133, 154
Asp700I GAANNNNTTC 1 cut(s) 117
AspLEI GCGC 2 cut(s) 45, 73
BarI GAAGNNNNNNTAC 2 cut(s) 232, 264
BccI CCATC 2 cut(s) 226, 249
BfaI CTAG 1 cut(s) 96
BmsI GCATC 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 57
BseGI GGATG 3 cut(s) 20, 229, 251
BseLI CCNNNNNNNGG 1 cut(s) 57
BseRI GAGGAG 1 cut(s) 40
BsgI GTGCAG 1 cut(s) 248
Bsh1236I CGCG 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 57
BspACI CCGC 1 cut(s) 24
BspFNI CGCG 1 cut(s) 45
BspHI TCATGA 1 cut(s) 198
Bst4CI ACNGT 1 cut(s) 8
Bst6I CTCTTC 3 cut(s) 58, 97, 108
BstAPI GCANNNNNTGC 1 cut(s) 32
BstC8I GCNNGC 1 cut(s) 75
BstF5I GGATG 3 cut(s) 20, 229, 251
BstFNI CGCG 1 cut(s) 45
BstHHI GCGC 2 cut(s) 45, 73
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstUI CGCG 1 cut(s) 45
BtsCI GGATG 3 cut(s) 20, 229, 251
Cac8I GCNNGC 1 cut(s) 75
CciI TCATGA 1 cut(s) 198
CfoI GCGC 2 cut(s) 45, 73
Csp6I GTAC 1 cut(s) 249
CviAII CATG 2 cut(s) 57, 199
CviJI RGCY 2 cut(s) 16, 211
CviKI_1 RGCY 2 cut(s) 16, 211
CviQI GTAC 1 cut(s) 249
Eam1104I CTCTTC 3 cut(s) 58, 97, 108
EarI CTCTTC 3 cut(s) 58, 97, 108
FaeI CATG 2 cut(s) 60, 202
FaiI YATR 6 cut(s) 37, 39, 58, 128, 200, 265
FalI AAGNNNNNCTT 2 cut(s) 105, 137
FatI CATG 2 cut(s) 56, 198
FokI GGATG 3 cut(s) 7, 236, 258
FspBI CTAG 1 cut(s) 96
GlaI GCGC 2 cut(s) 44, 72
HhaI GCGC 2 cut(s) 45, 73
Hin1II CATG 2 cut(s) 60, 202
Hin6I GCGC 2 cut(s) 43, 71
HinP1I GCGC 2 cut(s) 43, 71
HinfI GANTC 2 cut(s) 47, 89
Hpy188III TCNNGA 2 cut(s) 122, 199
HpyCH4III ACNGT 1 cut(s) 8
HpyCH4V TGCA 4 cut(s) 35, 77, 103, 229
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
Hsp92II CATG 2 cut(s) 60, 202
HspAI GCGC 2 cut(s) 43, 71
LpnPI CCDG 1 cut(s) 87
LweI GCATC 1 cut(s) 35
MaeI CTAG 1 cut(s) 96
MaeIII GTNAC 2 cut(s) 168, 213
MboII GAAGA 3 cut(s) 45, 84, 125
MlyI GAGTC 2 cut(s) 41, 83
MnlI CCTC 6 cut(s) 61, 109, 149, 187, 201, 214
MroXI GAANNNNTTC 1 cut(s) 117
MvnI CGCG 1 cut(s) 45
MwoI GCNNNNNNNGC 1 cut(s) 32
NlaIII CATG 2 cut(s) 60, 202
NmuCI GTSAC 1 cut(s) 213
PagI TCATGA 1 cut(s) 198
PdmI GAANNNNTTC 1 cut(s) 117
PleI GAGTC 2 cut(s) 41, 83
PpsI GAGTC 2 cut(s) 41, 83
RsaI GTAC 1 cut(s) 250
RsaNI GTAC 1 cut(s) 249
SchI GAGTC 2 cut(s) 41, 83
SetI ASST 3 cut(s) 120, 141, 198
SfaNI GCATC 1 cut(s) 35
SsiI CCGC 1 cut(s) 24
SspMI CTAG 1 cut(s) 96
TaaI ACNGT 1 cut(s) 8
TseFI GTSAC 1 cut(s) 213
Tsp45I GTSAC 1 cut(s) 213
TspDTI ATGAA 3 cut(s) 17, 45, 215
TspGWI ACGGA 1 cut(s) 169
XmnI GAANNNNTTC 1 cut(s) 117
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.