Rmu_sc0006543.1_g000003

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006543.1
Physical Location & Seq
Forward (+)
24121 .. 24567
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006543.1_g000003.1.cds

Sequence Viewer

Length: 447 bp
atgaaagaggggctgtctcaaatcaaggatgtgttggttgataaaagtattggattcaaggaagtacgacatcaagaaagcctagtgcagaagaagctgtccaagacattgggtcattcatcccagtgtttgttcacactcttgttatattacctttatgggcatgttagagatattgaagtagacttatcaggtggtctttatagcattagtgacaagagtctctgtctgtgcatgggtaggattgtgacttcagatgaggagacgatgatttggagtggggtgaagcagttggacagggctctcggtcttttcaagtttgtatgggaaacagcaggaatggaaggagttttgcaattgcaaggccatatatggtgtgtaggagccgagagcagaacacttacatatagaggaagcacattctttgtacatggaattcatgtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

16.67

Weight (kDa)

7.0

Isoelectric Point (pI)

28.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 183
AcsI RAATTY 1 cut(s) 435
AcuI CTGAAG 1 cut(s) 237
AfaI GTAC 2 cut(s) 66, 429
AgsI TTSAA 3 cut(s) 58, 179, 316
AhdI GACNNNNNGTC 1 cut(s) 111
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
Alw26I GTCTC 3 cut(s) 21, 227, 257
AoxI GGCC 1 cut(s) 364
ApoI RAATTY 1 cut(s) 435
AsuHPI GGTGA 1 cut(s) 295
BanII GRGCYC 1 cut(s) 304
BcoDI GTCTC 3 cut(s) 21, 227, 257
BfaI CTAG 1 cut(s) 83
BmeRI GACNNNNNGTC 1 cut(s) 111
BmiI GGNNCC 1 cut(s) 385
BmrI ACTGGG 1 cut(s) 118
BmuI ACTGGG 1 cut(s) 118
BoxI GACNNNNGTC 1 cut(s) 219
Bse1I ACTGG 1 cut(s) 124
BseGI GGATG 2 cut(s) 34, 119
BseNI ACTGG 1 cut(s) 124
BseRI GAGGAG 1 cut(s) 275
BsgI GTGCAG 1 cut(s) 107
BshFI GGCC 1 cut(s) 366
BsmAI GTCTC 3 cut(s) 21, 227, 257
BsmBI CGTCTC 1 cut(s) 257
BsnI GGCC 1 cut(s) 366
Bsp1286I GDGCHC 1 cut(s) 304
Bsp1407I TGTACA 1 cut(s) 427
BspANI GGCC 1 cut(s) 366
BspLI GGNNCC 1 cut(s) 385
BsrGI TGTACA 1 cut(s) 427
BsrI ACTGG 1 cut(s) 124
BstAUI TGTACA 1 cut(s) 427
BstF5I GGATG 2 cut(s) 34, 119
BstMAI GTCTC 3 cut(s) 21, 227, 257
BstMWI GCNNNNNNNGC 1 cut(s) 94
BstNSI RCATGY 1 cut(s) 167
BstPAI GACNNNNGTC 1 cut(s) 219
BstXI CCANNNNNNTGG 1 cut(s) 109
BsuRI GGCC 1 cut(s) 366
BtsCI GGATG 2 cut(s) 34, 119
BtsIMutI CAGTG 1 cut(s) 131
Csp6I GTAC 2 cut(s) 65, 428
CviAII CATG 4 cut(s) 164, 235, 431, 440
CviJI RGCY 6 cut(s) 13, 81, 97, 302, 366, 386
CviKI_1 RGCY 6 cut(s) 13, 81, 97, 302, 366, 386
CviQI GTAC 2 cut(s) 65, 428
DriI GACNNNNNGTC 1 cut(s) 111
Eam1105I GACNNNNNGTC 1 cut(s) 111
Eco24I GRGCYC 1 cut(s) 304
Eco57I CTGAAG 1 cut(s) 237
EcoRI GAATTC 1 cut(s) 435
EcoT38I GRGCYC 1 cut(s) 304
Esp3I CGTCTC 1 cut(s) 257
FaeI CATG 4 cut(s) 167, 238, 434, 443
FatI CATG 4 cut(s) 163, 234, 430, 439
FblI GTMKAC 1 cut(s) 183
FokI GGATG 2 cut(s) 41, 106
FriOI GRGCYC 1 cut(s) 304
FspBI CTAG 1 cut(s) 83
HaeIII GGCC 1 cut(s) 366
Hin1II CATG 4 cut(s) 167, 238, 434, 443
HinfI GANTC 2 cut(s) 54, 220
HphI GGTGA 1 cut(s) 295
Hpy166II GTNNAC 2 cut(s) 135, 184
Hpy188I TCNGA 1 cut(s) 256
Hpy188III TCNNGA 1 cut(s) 74
Hpy8I GTNNAC 2 cut(s) 135, 184
HpyAV CCTTC 1 cut(s) 338
HpyCH4V TGCA 4 cut(s) 88, 234, 355, 361
HpyF10VI GCNNNNNNNGC 1 cut(s) 94
Hsp92II CATG 4 cut(s) 167, 238, 434, 443
LmnI GCTCC 1 cut(s) 383
LpnPI CCDG 4 cut(s) 137, 177, 283, 321
MaeI CTAG 1 cut(s) 83
MaeIII GTNAC 2 cut(s) 212, 247
MboII GAAGA 1 cut(s) 103
MfeI CAATTG 1 cut(s) 356
MhlI GDGCHC 1 cut(s) 304
MluCI AATT 2 cut(s) 356, 435
MlyI GAGTC 1 cut(s) 229
MmeI TCCRAC 1 cut(s) 273
MnlI CCTC 2 cut(s) 253, 404
MslI CAYNNNNRTG 1 cut(s) 124
MunI CAATTG 1 cut(s) 356
MwoI GCNNNNNNNGC 1 cut(s) 94
NlaIII CATG 4 cut(s) 167, 238, 434, 443
NlaIV GGNNCC 1 cut(s) 385
NmeAIII GCCGAG 1 cut(s) 412
NmuCI GTSAC 2 cut(s) 212, 247
NspI RCATGY 1 cut(s) 167
PfeI GAWTC 1 cut(s) 54
PleI GAGTC 1 cut(s) 228
PpsI GAGTC 1 cut(s) 228
PshAI GACNNNNGTC 1 cut(s) 219
PspN4I GGNNCC 1 cut(s) 385
RsaI GTAC 2 cut(s) 66, 429
RsaNI GTAC 2 cut(s) 65, 428
RseI CAYNNNNRTG 1 cut(s) 124
SchI GAGTC 1 cut(s) 229
SduI GDGCHC 1 cut(s) 304
SetI ASST 3 cut(s) 99, 156, 196
SmiMI CAYNNNNRTG 1 cut(s) 124
Sse9I AATT 2 cut(s) 356, 435
SspMI CTAG 1 cut(s) 83
TaqII GACCGA 1 cut(s) 296
TasI AATT 2 cut(s) 356, 435
TatI WGTACW 1 cut(s) 427
TfiI GAWTC 1 cut(s) 54
TscAI CASTG 1 cut(s) 131
TseFI GTSAC 2 cut(s) 212, 247
Tsp45I GTSAC 2 cut(s) 212, 247
TspDTI ATGAA 3 cut(s) 17, 108, 428
TspRI CASTG 1 cut(s) 131
XapI RAATTY 1 cut(s) 435
XceI RCATGY 1 cut(s) 167
XmiI GTMKAC 1 cut(s) 183
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.