Rmu_sc0028459.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028459.1
Physical Location & Seq
Reverse (-)
2 .. 257
256 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028459.1_g000001.1.cds

Sequence Viewer

Length: 256 bp
atggagaaggtgatctatggtgcgaggcatgtaatgggtaagcgaaatggagccctgcatttgaatgtgatgctatatcatggctcagaggagtctcgtggggagcctttgtccctggaatggtatagaaaggcatttcccaagttgacgaaactgacccggttgcttaaagatgtggacttggttgatgggaggcttgttaatatcaatgatggttcgattatcgtgaatggccgagctgaacacaaaatggttg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.69

Weight (kDa)

9.63

Isoelectric Point (pI)

22.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 232
AfiI CCNNNNNNNGG 1 cut(s) 120
AgsI TTSAA 1 cut(s) 64
AjnI CCWGG 1 cut(s) 114
AluBI AGCT 1 cut(s) 239
AluI AGCT 1 cut(s) 239
Alw26I GTCTC 1 cut(s) 99
AoxI GGCC 1 cut(s) 232
AsuC2I CCSGG 1 cut(s) 160
AsuHPI GGTGA 1 cut(s) 22
BanII GRGCYC 1 cut(s) 55
BauI CACGAG 1 cut(s) 96
BccI CCATC 2 cut(s) 182, 206
BciT130I CCWGG 1 cut(s) 116
BcnI CCSGG 1 cut(s) 160
BcoDI GTCTC 1 cut(s) 99
Bme1390I CCNGG 2 cut(s) 116, 160
BmiI GGNNCC 2 cut(s) 52, 105
BmrFI CCNGG 2 cut(s) 116, 160
BmsI GCATC 1 cut(s) 60
BpuMI CCSGG 1 cut(s) 160
BsaJI CCNNGG 1 cut(s) 114
BsaXI ACNNNNNCTCC 2 cut(s) 95, 125
Bsc4I CCNNNNNNNGG 1 cut(s) 120
BseBI CCWGG 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 99
BseRI GAGGAG 1 cut(s) 104
BshFI GGCC 1 cut(s) 234
BsiSI CCGG 1 cut(s) 160
BslFI GGGAC 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 120
BsmAI GTCTC 1 cut(s) 99
BsmFI GGGAC 1 cut(s) 97
BsnI GGCC 1 cut(s) 234
Bsp1286I GDGCHC 1 cut(s) 55
Bsp143I GATC 1 cut(s) 12
BspANI GGCC 1 cut(s) 234
BspCNI CTCAG 1 cut(s) 98
BspLI GGNNCC 2 cut(s) 52, 105
BssECI CCNNGG 1 cut(s) 114
BssMI GATC 1 cut(s) 12
BssSI CACGAG 1 cut(s) 96
Bst2BI CACGAG 1 cut(s) 96
Bst2UI CCWGG 1 cut(s) 116
BstDEI CTNAG 1 cut(s) 85
BstKTI GATC 1 cut(s) 15
BstMAI GTCTC 1 cut(s) 99
BstMBI GATC 1 cut(s) 12
BstNI CCWGG 1 cut(s) 116
BstNSI RCATGY 1 cut(s) 32
BstSCI CCNGG 2 cut(s) 114, 158
BsuRI GGCC 1 cut(s) 234
CviAII CATG 2 cut(s) 29, 80
CviJI RGCY 6 cut(s) 53, 84, 106, 196, 234, 239
CviKI_1 RGCY 6 cut(s) 53, 84, 106, 196, 234, 239
DdeI CTNAG 1 cut(s) 85
DpnI GATC 1 cut(s) 14
DpnII GATC 1 cut(s) 12
EaeI YGGCCR 1 cut(s) 232
Eco24I GRGCYC 1 cut(s) 55
EcoRII CCWGG 1 cut(s) 114
EcoT38I GRGCYC 1 cut(s) 55
FaeI CATG 2 cut(s) 32, 83
FaiI YATR 5 cut(s) 18, 30, 76, 81, 126
FaqI GGGAC 1 cut(s) 97
FatI CATG 2 cut(s) 28, 79
FriOI GRGCYC 1 cut(s) 55
HaeIII GGCC 1 cut(s) 234
HapII CCGG 1 cut(s) 160
Hin1II CATG 2 cut(s) 32, 83
HincII GTYRAC 1 cut(s) 147
HindII GTYRAC 1 cut(s) 147
HinfI GANTC 1 cut(s) 92
HpaII CCGG 1 cut(s) 160
HphI GGTGA 1 cut(s) 22
Hpy166II GTNNAC 2 cut(s) 147, 178
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 226
Hpy8I GTNNAC 2 cut(s) 147, 178
HpyCH4V TGCA 1 cut(s) 58
HpyF3I CTNAG 1 cut(s) 85
Hsp92II CATG 2 cut(s) 32, 83
Kzo9I GATC 1 cut(s) 12
LmnI GCTCC 2 cut(s) 50, 103
LpnPI CCDG 4 cut(s) 68, 101, 128, 173
LweI GCATC 1 cut(s) 60
MalI GATC 1 cut(s) 14
MboI GATC 1 cut(s) 12
MhlI GDGCHC 1 cut(s) 55
MlyI GAGTC 1 cut(s) 101
MnlI CCTC 3 cut(s) 18, 82, 186
MseI TTAA 2 cut(s) 168, 201
MslI CAYNNNNRTG 1 cut(s) 63
MspI CCGG 1 cut(s) 160
MspR9I CCNGG 2 cut(s) 116, 160
MvaI CCWGG 1 cut(s) 116
NciI CCSGG 1 cut(s) 160
NdeII GATC 1 cut(s) 12
NlaIII CATG 2 cut(s) 32, 83
NlaIV GGNNCC 2 cut(s) 52, 105
NspI RCATGY 1 cut(s) 32
PleI GAGTC 1 cut(s) 100
PpsI GAGTC 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 2 cut(s) 52, 105
RseI CAYNNNNRTG 1 cut(s) 63
SaqAI TTAA 2 cut(s) 168, 201
Sau3AI GATC 1 cut(s) 12
SchI GAGTC 1 cut(s) 101
ScrFI CCNGG 2 cut(s) 116, 160
SduI GDGCHC 1 cut(s) 55
SetI ASST 2 cut(s) 12, 241
SfaNI GCATC 1 cut(s) 60
SmiMI CAYNNNNRTG 1 cut(s) 63
StyD4I CCNGG 2 cut(s) 114, 158
TaqI TCGA 1 cut(s) 218
Tru1I TTAA 2 cut(s) 168, 201
Tru9I TTAA 2 cut(s) 168, 201
XceI RCATGY 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.