pycom09g08790

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
OG0001657
Physical Location & Seq
Reverse (-)
6873219 .. 6874769
1551 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g08790.4

Sequence Viewer

Length: 573 bp
ATGTGTGGTCACATAGAGTTGAGTAATATACATGTTCTTGAATGCCAGGTCAACACATCAGGAGAGATTGATAACAATACTCCACAGTACTCTATCAGCGCTGAGATAACTGACTTGGTGATGTCTTTAAATGAGGTTCAGTTGCAACAAATCTTATTTCTTTGGGATTTTTTAGGCACATGTGAATTGAGAAATAAGTATGGGCGTTATCATCCCTGGTGTAGTCCGTTACCAACAAAAATGAAGGGTTGGCAATTACGGTGGTGGCATTATGCGCTAGAATCTGTTCTATCAGATGTTCATAAGAGATTAAAGAAACCTCATGGAGATATTTTGGACAGAGACTGTAAGTCCATTTCTGTTTTGATTTTACCCTCTTCTATACCAAGTGCAACATTAAAAAGTACAAGTCTGTTCTGCTTGGTTTCTGCTCACTCAGTTTTTTCGTATTTGATGTGTGTGTGTGTGTGTATGTGTTTATCTTTTGATAAAGAAACGATTATATTAAAAGAGGAAATATGCAGTAACAACAAAAAGGGTGGTCAAGCAAAGCACCCGAACATGTCTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
VPS13

Protein Analysis

191

Amino Acids

21.62

Weight (kDa)

7.05

Isoelectric Point (pI)

61.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 89, 406
AfeI AGCGCT 1 cut(s) 100
AflIII ACRYGT 3 cut(s) 31, 179, 561
AgsI TTSAA 1 cut(s) 41
AhdI GACNNNNNGTC 1 cut(s) 349
AjnI CCWGG 2 cut(s) 45, 215
Alw26I GTCTC 1 cut(s) 336
AlwNI CAGNNNCTG 1 cut(s) 345
Aor51HI AGCGCT 1 cut(s) 100
Asp700I GAANNNNTTC 1 cut(s) 285
AspLEI GCGC 2 cut(s) 101, 277
AsuHPI GGTGA 1 cut(s) 130
BciT130I CCWGG 2 cut(s) 47, 217
BcoDI GTCTC 1 cut(s) 336
BfaI CTAG 1 cut(s) 278
BfoI RGCGCY 1 cut(s) 102
BmcAI AGTACT 1 cut(s) 89
Bme1390I CCNGG 2 cut(s) 47, 217
BmeRI GACNNNNNGTC 1 cut(s) 349
BmrFI CCNGG 2 cut(s) 47, 217
BsaJI CCNNGG 1 cut(s) 215
BseBI CCWGG 2 cut(s) 47, 217
BseDI CCNNGG 1 cut(s) 215
BseGI GGATG 1 cut(s) 211
BseMII CTCAG 2 cut(s) 93, 450
BsmAI GTCTC 1 cut(s) 336
BsmI GAATGC 1 cut(s) 47
BspCNI CTCAG 2 cut(s) 94, 449
BssECI CCNNGG 1 cut(s) 215
Bst2UI CCWGG 2 cut(s) 47, 217
Bst4CI ACNGT 3 cut(s) 87, 261, 347
Bst6I CTCTTC 1 cut(s) 382
BstDEI CTNAG 2 cut(s) 102, 436
BstF5I GGATG 1 cut(s) 211
BstH2I RGCGCY 1 cut(s) 102
BstHHI GCGC 2 cut(s) 101, 277
BstMAI GTCTC 1 cut(s) 336
BstMWI GCNNNNNNNGC 1 cut(s) 274
BstNI CCWGG 2 cut(s) 47, 217
BstNSI RCATGY 3 cut(s) 35, 183, 565
BstSCI CCNGG 2 cut(s) 45, 215
BtsCI GGATG 1 cut(s) 211
CaiI CAGNNNCTG 1 cut(s) 345
CfoI GCGC 2 cut(s) 101, 277
Csp6I GTAC 2 cut(s) 88, 405
CspCI CAANNNNNGTGG 4 cut(s) 242, 277, 520, 555
CviAII CATG 4 cut(s) 32, 180, 323, 562
CviQI GTAC 2 cut(s) 88, 405
DdeI CTNAG 2 cut(s) 102, 436
DraI TTTAAA 1 cut(s) 129
DriI GACNNNNNGTC 1 cut(s) 349
Eam1104I CTCTTC 1 cut(s) 382
Eam1105I GACNNNNNGTC 1 cut(s) 349
EarI CTCTTC 1 cut(s) 382
Eco47III AGCGCT 1 cut(s) 100
EcoRII CCWGG 2 cut(s) 45, 215
FaeI CATG 4 cut(s) 35, 183, 326, 565
FatI CATG 4 cut(s) 31, 179, 322, 561
FokI GGATG 1 cut(s) 198
FspBI CTAG 1 cut(s) 278
GlaI GCGC 2 cut(s) 100, 276
HaeII RGCGCY 1 cut(s) 102
HhaI GCGC 2 cut(s) 101, 277
Hin1II CATG 4 cut(s) 35, 183, 326, 565
Hin6I GCGC 2 cut(s) 99, 275
HinP1I GCGC 2 cut(s) 99, 275
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HinfI GANTC 1 cut(s) 281
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 295
Hpy188III TCNNGA 2 cut(s) 38, 60
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 238
HpyCH4III ACNGT 3 cut(s) 87, 261, 347
HpyCH4V TGCA 3 cut(s) 145, 392, 522
HpyF10VI GCNNNNNNNGC 1 cut(s) 274
HpyF3I CTNAG 2 cut(s) 102, 436
Hsp92II CATG 4 cut(s) 35, 183, 326, 565
HspAI GCGC 2 cut(s) 99, 275
LpnPI CCDG 5 cut(s) 32, 45, 59, 202, 229
MaeI CTAG 1 cut(s) 278
MaeIII GTNAC 3 cut(s) 8, 228, 524
MboII GAAGA 1 cut(s) 369
MluCI AATT 2 cut(s) 185, 254
MnlI CCTC 4 cut(s) 127, 330, 385, 505
MroXI GAANNNNTTC 1 cut(s) 285
MseI TTAA 4 cut(s) 128, 311, 398, 506
MspR9I CCNGG 2 cut(s) 47, 217
Mva1269I GAATGC 1 cut(s) 47
MvaI CCWGG 2 cut(s) 47, 217
MwoI GCNNNNNNNGC 1 cut(s) 274
NlaIII CATG 4 cut(s) 35, 183, 326, 565
NmuCI GTSAC 1 cut(s) 8
NspI RCATGY 3 cut(s) 35, 183, 565
PciI ACATGT 3 cut(s) 31, 179, 561
PctI GAATGC 1 cut(s) 47
PdmI GAANNNNTTC 1 cut(s) 285
PfeI GAWTC 1 cut(s) 281
PscI ACATGT 3 cut(s) 31, 179, 561
Psp6I CCWGG 2 cut(s) 45, 215
PspGI CCWGG 2 cut(s) 45, 215
PstNI CAGNNNCTG 1 cut(s) 345
RsaI GTAC 2 cut(s) 89, 406
RsaNI GTAC 2 cut(s) 88, 405
SaqAI TTAA 4 cut(s) 128, 311, 398, 506
ScaI AGTACT 1 cut(s) 89
ScrFI CCNGG 2 cut(s) 47, 217
SetI ASST 3 cut(s) 51, 138, 322
Sse9I AATT 2 cut(s) 185, 254
SspMI CTAG 1 cut(s) 278
StyD4I CCNGG 2 cut(s) 45, 215
TaaI ACNGT 3 cut(s) 87, 261, 347
TasI AATT 2 cut(s) 185, 254
TatI WGTACW 2 cut(s) 87, 404
TfiI GAWTC 1 cut(s) 281
Tru1I TTAA 4 cut(s) 128, 311, 398, 506
Tru9I TTAA 4 cut(s) 128, 311, 398, 506
TseFI GTSAC 1 cut(s) 8
Tsp45I GTSAC 1 cut(s) 8
TspDTI ATGAA 2 cut(s) 257, 290
TspGWI ACGGA 1 cut(s) 216
XceI RCATGY 3 cut(s) 35, 183, 565
XmnI GAANNNNTTC 1 cut(s) 285
XspI CTAG 1 cut(s) 278
ZrmI AGTACT 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.