pycom10g15890

Patellin-4-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
19073543 .. 19073863
321 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g15890.1

Sequence Viewer

Length: 216 bp
ATGAATGAGCTTCGTTCTCGTAGCAACAAAACCCTAGTTTTTCTCCAAGAAAACTATCCAGAGCTCATTCAAAAGAATTTAAGTAGTATTGTGATAAATGCTCCTCTTTGGTATTATTTGCTGCGTGTGCTCGGATCAAGGTTCCTAAGTCAAAGAACCAAAATGAAGTTTGTGTTTGCCAGGCCTTCAGACGTTACAAAAACCCTTCTCAAGTAA
Functional Annotation

Protein Analysis

72

Amino Acids

8.41

Weight (kDa)

10.49

Isoelectric Point (pI)

67.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 142
AcsI RAATTY 1 cut(s) 76
AcuI CTGAAG 1 cut(s) 171
AgsI TTSAA 1 cut(s) 71
AjnI CCWGG 1 cut(s) 179
AluBI AGCT 2 cut(s) 10, 64
AluI AGCT 2 cut(s) 10, 64
Alw21I GWGCWC 2 cut(s) 66, 132
AlwI GGATC 1 cut(s) 142
AoxI GGCC 1 cut(s) 182
ApeKI GCWGC 1 cut(s) 121
ApoI RAATTY 1 cut(s) 76
BanII GRGCYC 1 cut(s) 66
Bbv12I GWGCWC 2 cut(s) 66, 132
BbvI GCAGC 1 cut(s) 108
BciT130I CCWGG 1 cut(s) 181
BfaI CTAG 1 cut(s) 35
BisI GCNGC 1 cut(s) 122
BlsI GCNGC 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 181
BmiI GGNNCC 1 cut(s) 143
BmrFI CCNGG 1 cut(s) 181
BpuEI CTTGAG 1 cut(s) 194
BseBI CCWGG 1 cut(s) 181
BseRI GAGGAG 1 cut(s) 93
BseXI GCAGC 1 cut(s) 108
BshFI GGCC 1 cut(s) 184
BsiHKAI GWGCWC 2 cut(s) 66, 132
BsnI GGCC 1 cut(s) 184
Bsp1286I GDGCHC 2 cut(s) 66, 132
Bsp143I GATC 1 cut(s) 134
BspANI GGCC 1 cut(s) 184
BspLI GGNNCC 1 cut(s) 143
BspPI GGATC 1 cut(s) 142
BssMI GATC 1 cut(s) 134
Bst2UI CCWGG 1 cut(s) 181
BstDEI CTNAG 1 cut(s) 146
BstKTI GATC 1 cut(s) 137
BstMBI GATC 1 cut(s) 134
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNI CCWGG 1 cut(s) 181
BstSCI CCNGG 1 cut(s) 179
BstV1I GCAGC 1 cut(s) 108
BsuRI GGCC 1 cut(s) 184
CviJI RGCY 3 cut(s) 10, 64, 184
CviKI_1 RGCY 3 cut(s) 10, 64, 184
DdeI CTNAG 1 cut(s) 146
DpnI GATC 1 cut(s) 136
DpnII GATC 1 cut(s) 134
Ecl136II GAGCTC 1 cut(s) 64
Eco147I AGGCCT 1 cut(s) 184
Eco24I GRGCYC 1 cut(s) 66
Eco53kI GAGCTC 1 cut(s) 64
Eco57I CTGAAG 1 cut(s) 171
EcoICRI GAGCTC 1 cut(s) 64
EcoRII CCWGG 1 cut(s) 179
EcoT38I GRGCYC 1 cut(s) 66
Fnu4HI GCNGC 1 cut(s) 122
FriOI GRGCYC 1 cut(s) 66
Fsp4HI GCNGC 1 cut(s) 122
FspBI CTAG 1 cut(s) 35
GluI GCNGC 1 cut(s) 122
HaeIII GGCC 1 cut(s) 184
Hpy188I TCNGA 2 cut(s) 134, 190
Hpy188III TCNNGA 1 cut(s) 59
HpyAV CCTTC 2 cut(s) 195, 215
HpyCH4IV ACGT 1 cut(s) 192
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HpyF3I CTNAG 1 cut(s) 146
HpySE526I ACGT 1 cut(s) 192
Kzo9I GATC 1 cut(s) 134
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 3 cut(s) 72, 166, 193
Lsp1109I GCAGC 1 cut(s) 108
MaeI CTAG 1 cut(s) 35
MaeII ACGT 1 cut(s) 192
MaeIII GTNAC 1 cut(s) 193
MalI GATC 1 cut(s) 136
MboI GATC 1 cut(s) 134
MhlI GDGCHC 2 cut(s) 66, 132
MluCI AATT 1 cut(s) 76
MnlI CCTC 1 cut(s) 114
MseI TTAA 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 181
MvaI CCWGG 1 cut(s) 181
MwoI GCNNNNNNNGC 1 cut(s) 127
NdeII GATC 1 cut(s) 134
NlaIV GGNNCC 1 cut(s) 143
PceI AGGCCT 1 cut(s) 184
PkrI GCNGC 1 cut(s) 123
Psp124BI GAGCTC 1 cut(s) 66
Psp6I CCWGG 1 cut(s) 179
PspGI CCWGG 1 cut(s) 179
PspN4I GGNNCC 1 cut(s) 143
SacI GAGCTC 1 cut(s) 66
SaqAI TTAA 1 cut(s) 80
SatI GCNGC 1 cut(s) 122
Sau3AI GATC 1 cut(s) 134
ScrFI CCNGG 1 cut(s) 181
SduI GDGCHC 2 cut(s) 66, 132
SetI ASST 4 cut(s) 12, 66, 143, 195
SgeI CNNG 9 cut(s) 30, 47, 59, 71, 137, 143, 150, 192, 193
SmlI CTYRAG 1 cut(s) 209
SmoI CTYRAG 1 cut(s) 209
Sse9I AATT 1 cut(s) 76
SseBI AGGCCT 1 cut(s) 184
SspMI CTAG 1 cut(s) 35
SstI GAGCTC 1 cut(s) 66
StuI AGGCCT 1 cut(s) 184
StyD4I CCNGG 1 cut(s) 179
TaiI ACGT 1 cut(s) 195
TasI AATT 1 cut(s) 76
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
TseI GCWGC 1 cut(s) 121
TspDTI ATGAA 2 cut(s) 17, 179
XapI RAATTY 1 cut(s) 76
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.