Rh3AG217100

Patellin-3-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0008892
Physical Location & Seq
Reverse (-)
22018576 .. 22020161
1586 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG217100.1

Sequence Viewer

Length: 348 bp
ATGACCAACCGGCCATACAATGATCCAAGTCAACCATTGTACCCTTACGATAGGTGTTTGATCAATGGTCCATCGTGGTATCTTGCATTCTACATATTGACAAGCCCCTTCTTGACACTGAGGACCAAAACCAAGTTTGTCTTTGCAAGCCCAGGCAAATCTGCAGAGACCCCTTTGAAGTACATTTCTGCTGAGCATGTTCCTAGCCAATATGGAGGTTTGAGTGTGGATTATTGTGATTGCAAAATGGAATTCACGATTGCTGATCCAATGTCTGAATTAACCATCAAACGAGGGATGAAGAAGACTCTGGAAATTATAATTTATGAGGTGATTTCCCTAGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005886 GO:0009507 GO:0009536 GO:0016020 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CRAL_TRIO CRAL_TRIO_N

Protein Analysis

115

Amino Acids

13.1

Weight (kDa)

7.66

Isoelectric Point (pI)

47.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CRAL_TRIO PF00650 20 - 73 4.8e-06 CRAL/TRIO domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 320
AclWI GGATC 2 cut(s) 17, 260
AcoI YGGCCR 1 cut(s) 11
AcsI RAATTY 1 cut(s) 251
AfaI GTAC 2 cut(s) 41, 182
AgsI TTSAA 1 cut(s) 178
AjnI CCWGG 1 cut(s) 151
AluBI AGCT 1 cut(s) 344
AluI AGCT 1 cut(s) 344
Alw26I GTCTC 1 cut(s) 161
AlwI GGATC 2 cut(s) 17, 260
AoxI GGCC 1 cut(s) 11
ApoI RAATTY 1 cut(s) 251
AspS9I GGNCC 2 cut(s) 68, 123
AsuHPI GGTGA 1 cut(s) 343
AvaII GGWCC 2 cut(s) 68, 123
BaeI ACNNNNGTAYC 2 cut(s) 23, 56
BbsI GAAGAC 1 cut(s) 311
BccI CCATC 2 cut(s) 79, 293
BciT130I CCWGG 1 cut(s) 153
BclI TGATCA 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 161
BfaI CTAG 2 cut(s) 204, 341
BfmI CTRYAG 1 cut(s) 162
BlpI GCTNAGC 1 cut(s) 192
Bme1390I CCNGG 1 cut(s) 153
Bme18I GGWCC 2 cut(s) 68, 123
BmgT120I GGNCC 2 cut(s) 68, 123
BmrFI CCNGG 1 cut(s) 153
BpiI GAAGAC 1 cut(s) 311
Bpu1102I GCTNAGC 1 cut(s) 192
BsaI GGTCTC 1 cut(s) 161
BsaJI CCNNGG 1 cut(s) 151
Bse118I RCCGGY 1 cut(s) 9
BseBI CCWGG 1 cut(s) 153
BseDI CCNNGG 1 cut(s) 151
BseGI GGATG 1 cut(s) 303
BseMII CTCAG 2 cut(s) 110, 183
BshFI GGCC 1 cut(s) 13
BsiSI CCGG 1 cut(s) 10
BsmAI GTCTC 1 cut(s) 161
BsmI GAATGC 1 cut(s) 86
BsnI GGCC 1 cut(s) 13
Bso31I GGTCTC 1 cut(s) 161
Bsp143I GATC 3 cut(s) 22, 60, 265
Bsp1720I GCTNAGC 1 cut(s) 192
BspANI GGCC 1 cut(s) 13
BspCNI CTCAG 2 cut(s) 111, 184
BspMAI CTGCAG 1 cut(s) 166
BspPI GGATC 2 cut(s) 17, 260
BspTNI GGTCTC 1 cut(s) 161
BsrFI RCCGGY 1 cut(s) 9
BssAI RCCGGY 1 cut(s) 9
BssECI CCNNGG 1 cut(s) 151
BssMI GATC 3 cut(s) 22, 60, 265
Bst2UI CCWGG 1 cut(s) 153
BstC8I GCNNGC 1 cut(s) 148
BstDEI CTNAG 3 cut(s) 119, 192, 345
BstF5I GGATG 1 cut(s) 303
BstKTI GATC 3 cut(s) 25, 63, 268
BstMAI GTCTC 1 cut(s) 161
BstMBI GATC 3 cut(s) 22, 60, 265
BstNI CCWGG 1 cut(s) 153
BstNSI RCATGY 1 cut(s) 200
BstSCI CCNGG 1 cut(s) 151
BstSFI CTRYAG 1 cut(s) 162
BstV2I GAAGAC 1 cut(s) 311
BsuRI GGCC 1 cut(s) 13
BtsCI GGATG 1 cut(s) 303
BtsIMutI CAGTG 1 cut(s) 116
Cac8I GCNNGC 1 cut(s) 148
Cfr10I RCCGGY 1 cut(s) 9
Cfr13I GGNCC 2 cut(s) 68, 123
Csp6I GTAC 2 cut(s) 40, 181
CviAII CATG 1 cut(s) 197
CviJI RGCY 5 cut(s) 13, 105, 150, 207, 344
CviKI_1 RGCY 5 cut(s) 13, 105, 150, 207, 344
CviQI GTAC 2 cut(s) 40, 181
DdeI CTNAG 3 cut(s) 119, 192, 345
DpnI GATC 3 cut(s) 24, 62, 267
DpnII GATC 3 cut(s) 22, 60, 265
EaeI YGGCCR 1 cut(s) 11
Eco31I GGTCTC 1 cut(s) 161
Eco47I GGWCC 2 cut(s) 68, 123
EcoRI GAATTC 1 cut(s) 251
EcoRII CCWGG 1 cut(s) 151
FaeI CATG 1 cut(s) 200
FaiI YATR 6 cut(s) 16, 95, 198, 213, 320, 327
FalI AAGNNNNNCTT 2 cut(s) 125, 157
FatI CATG 1 cut(s) 196
FbaI TGATCA 1 cut(s) 60
FokI GGATG 1 cut(s) 310
FspBI CTAG 2 cut(s) 204, 341
HaeIII GGCC 1 cut(s) 13
HapII CCGG 1 cut(s) 10
Hin1II CATG 1 cut(s) 200
HincII GTYRAC 1 cut(s) 32
HindII GTYRAC 1 cut(s) 32
HinfI GANTC 1 cut(s) 307
HpaII CCGG 1 cut(s) 10
HphI GGTGA 1 cut(s) 343
Hpy166II GTNNAC 1 cut(s) 32
Hpy188I TCNGA 1 cut(s) 277
Hpy188III TCNNGA 3 cut(s) 112, 256, 311
Hpy8I GTNNAC 1 cut(s) 32
HpyAV CCTTC 1 cut(s) 118
HpyCH4V TGCA 4 cut(s) 86, 146, 164, 243
HpyF3I CTNAG 3 cut(s) 119, 192, 345
Hsp92II CATG 1 cut(s) 200
Ksp22I TGATCA 1 cut(s) 60
Kzo9I GATC 3 cut(s) 22, 60, 265
LpnPI CCDG 4 cut(s) 23, 138, 165, 296
MaeI CTAG 2 cut(s) 204, 341
MalI GATC 3 cut(s) 24, 62, 267
MboI GATC 3 cut(s) 22, 60, 265
MboII GAAGA 2 cut(s) 313, 316
MluCI AATT 4 cut(s) 251, 278, 315, 321
MlyI GAGTC 1 cut(s) 301
MnlI CCTC 4 cut(s) 114, 209, 287, 322
MseI TTAA 1 cut(s) 281
MspI CCGG 1 cut(s) 10
MspR9I CCNGG 1 cut(s) 153
Mva1269I GAATGC 1 cut(s) 86
MvaI CCWGG 1 cut(s) 153
NdeII GATC 3 cut(s) 22, 60, 265
NlaIII CATG 1 cut(s) 200
NspI RCATGY 1 cut(s) 200
PctI GAATGC 1 cut(s) 86
PleI GAGTC 1 cut(s) 301
PpsI GAGTC 1 cut(s) 301
PsiI TTATAA 1 cut(s) 320
Psp6I CCWGG 1 cut(s) 151
PspGI CCWGG 1 cut(s) 151
PspPI GGNCC 2 cut(s) 68, 123
PstI CTGCAG 1 cut(s) 166
RsaI GTAC 2 cut(s) 41, 182
RsaNI GTAC 2 cut(s) 40, 181
SaqAI TTAA 1 cut(s) 281
Sau3AI GATC 3 cut(s) 22, 60, 265
Sau96I GGNCC 2 cut(s) 68, 123
SchI GAGTC 1 cut(s) 301
ScrFI CCNGG 1 cut(s) 153
SetI ASST 4 cut(s) 56, 220, 333, 346
SfcI CTRYAG 1 cut(s) 162
SinI GGWCC 2 cut(s) 68, 123
Sse9I AATT 4 cut(s) 251, 278, 315, 321
SspMI CTAG 2 cut(s) 204, 341
StyD4I CCNGG 1 cut(s) 151
TasI AATT 4 cut(s) 251, 278, 315, 321
TatI WGTACW 1 cut(s) 180
Tru1I TTAA 1 cut(s) 281
Tru9I TTAA 1 cut(s) 281
TscAI CASTG 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 314
TspRI CASTG 1 cut(s) 123
VpaK11BI GGWCC 2 cut(s) 68, 123
XapI RAATTY 1 cut(s) 251
XceI RCATGY 1 cut(s) 200
XspI CTAG 2 cut(s) 204, 341
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.