Rroxscaffold_7G00186110

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
25530290 .. 25530671
382 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00186110.1

Sequence Viewer

Length: 225 bp
ATGAACCCTAGTTTCACAAATTCCAAAATTCGATCTCTACAGATCGAATCGCTGCAAGAGGTTTTGAGGATAGCATCCACGTCTTCTGGGCTAGAAAAACCCTCAAAGAATTCGAGCTATGATGGCCGGAGTTGGGAGAACCAAGGCCGGCGAATTTGGGCGATTTCGGCTCGGCGGAGTAACTTCACGGGGTTGCGGCGGCCTCCACGGTGCTTCCCATGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.46

Weight (kDa)

11.16

Isoelectric Point (pI)

84.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 175, 196, 199
AcoI YGGCCR 1 cut(s) 124
AcsI RAATTY 4 cut(s) 19, 27, 109, 153
AfiI CCNNNNNNNGG 1 cut(s) 133
AjiI CACGTC 1 cut(s) 81
AluBI AGCT 1 cut(s) 117
AluI AGCT 1 cut(s) 117
AoxI GGCC 3 cut(s) 124, 145, 200
ApeKI GCWGC 1 cut(s) 52
ApoI RAATTY 4 cut(s) 19, 27, 109, 153
BbsI GAAGAC 1 cut(s) 75
BbvI GCAGC 1 cut(s) 39
BccI CCATC 1 cut(s) 116
BfaI CTAG 2 cut(s) 9, 92
BfmI CTRYAG 1 cut(s) 38
BisI GCNGC 3 cut(s) 53, 197, 200
BlsI GCNGC 3 cut(s) 54, 198, 201
BmgBI CACGTC 1 cut(s) 81
BmsI GCATC 1 cut(s) 83
BpiI GAAGAC 1 cut(s) 75
BsaJI CCNNGG 2 cut(s) 142, 206
Bsc4I CCNNNNNNNGG 1 cut(s) 133
Bse118I RCCGGY 1 cut(s) 147
BseDI CCNNGG 2 cut(s) 142, 206
BseGI GGATG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 133
BseXI GCAGC 1 cut(s) 39
BshFI GGCC 3 cut(s) 126, 147, 202
BsiSI CCGG 2 cut(s) 127, 148
BslI CCNNNNNNNGG 1 cut(s) 133
BsnI GGCC 3 cut(s) 126, 147, 202
Bsp143I GATC 2 cut(s) 32, 42
BspACI CCGC 3 cut(s) 175, 196, 199
BspANI GGCC 3 cut(s) 126, 147, 202
BsrFI RCCGGY 1 cut(s) 147
BssAI RCCGGY 1 cut(s) 147
BssECI CCNNGG 2 cut(s) 142, 206
BssMI GATC 2 cut(s) 32, 42
BssT1I CCWWGG 1 cut(s) 142
Bst4CI ACNGT 1 cut(s) 210
BstC8I GCNNGC 1 cut(s) 149
BstDSI CCRYGG 1 cut(s) 206
BstF5I GGATG 1 cut(s) 74
BstKTI GATC 2 cut(s) 35, 45
BstMBI GATC 2 cut(s) 32, 42
BstMWI GCNNNNNNNGC 3 cut(s) 123, 167, 219
BstSFI CTRYAG 1 cut(s) 38
BstV1I GCAGC 1 cut(s) 39
BstV2I GAAGAC 1 cut(s) 75
BsuRI GGCC 3 cut(s) 126, 147, 202
BtgI CCRYGG 1 cut(s) 206
BtrI CACGTC 1 cut(s) 81
BtsCI GGATG 1 cut(s) 74
Cac8I GCNNGC 1 cut(s) 149
Cfr10I RCCGGY 1 cut(s) 147
CviAII CATG 1 cut(s) 219
CviJI RGCY 6 cut(s) 91, 117, 126, 147, 170, 202
CviKI_1 RGCY 6 cut(s) 91, 117, 126, 147, 170, 202
DpnI GATC 2 cut(s) 34, 44
DpnII GATC 2 cut(s) 32, 42
EaeI YGGCCR 1 cut(s) 124
EciI GGCGGA 1 cut(s) 190
Eco130I CCWWGG 1 cut(s) 142
EcoRI GAATTC 1 cut(s) 109
EcoT14I CCWWGG 1 cut(s) 142
ErhI CCWWGG 1 cut(s) 142
FaeI CATG 1 cut(s) 222
FaiI YATR 2 cut(s) 120, 220
FatI CATG 1 cut(s) 218
Fnu4HI GCNGC 3 cut(s) 53, 197, 200
FokI GGATG 1 cut(s) 61
Fsp4HI GCNGC 3 cut(s) 53, 197, 200
FspBI CTAG 2 cut(s) 9, 92
GluI GCNGC 3 cut(s) 53, 197, 200
HaeIII GGCC 3 cut(s) 126, 147, 202
HapII CCGG 2 cut(s) 127, 148
Hin1II CATG 1 cut(s) 222
HinfI GANTC 1 cut(s) 47
HpaII CCGG 2 cut(s) 127, 148
HpyCH4III ACNGT 1 cut(s) 210
HpyCH4IV ACGT 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 3 cut(s) 123, 167, 219
HpySE526I ACGT 1 cut(s) 80
Hsp92II CATG 1 cut(s) 222
KroI GCCGGC 1 cut(s) 147
KroNI GCCGGC 1 cut(s) 149
Kzo9I GATC 2 cut(s) 32, 42
LpnPI CCDG 3 cut(s) 72, 140, 161
Lsp1109I GCAGC 1 cut(s) 39
LweI GCATC 1 cut(s) 83
MaeI CTAG 2 cut(s) 9, 92
MaeII ACGT 1 cut(s) 80
MaeIII GTNAC 1 cut(s) 179
MalI GATC 2 cut(s) 34, 44
MboI GATC 2 cut(s) 32, 42
MboII GAAGA 1 cut(s) 75
MluCI AATT 4 cut(s) 19, 27, 109, 153
MnlI CCTC 4 cut(s) 52, 60, 112, 213
MroNI GCCGGC 1 cut(s) 147
MspI CCGG 2 cut(s) 127, 148
MwoI GCNNNNNNNGC 3 cut(s) 123, 167, 219
NaeI GCCGGC 1 cut(s) 149
NdeII GATC 2 cut(s) 32, 42
NgoMIV GCCGGC 1 cut(s) 147
NlaIII CATG 1 cut(s) 222
NmeAIII GCCGAG 1 cut(s) 151
PdiI GCCGGC 1 cut(s) 149
PfeI GAWTC 1 cut(s) 47
PkrI GCNGC 3 cut(s) 54, 198, 201
SatI GCNGC 3 cut(s) 53, 197, 200
Sau3AI GATC 2 cut(s) 32, 42
SetI ASST 3 cut(s) 63, 83, 119
SfaNI GCATC 1 cut(s) 83
SfcI CTRYAG 1 cut(s) 38
Sse9I AATT 4 cut(s) 19, 27, 109, 153
SsiI CCGC 3 cut(s) 175, 196, 199
SspMI CTAG 2 cut(s) 9, 92
StyI CCWWGG 1 cut(s) 142
TaaI ACNGT 1 cut(s) 210
TaiI ACGT 1 cut(s) 83
TaqI TCGA 3 cut(s) 31, 45, 113
TasI AATT 4 cut(s) 19, 27, 109, 153
TauI GCSGC 2 cut(s) 199, 202
TfiI GAWTC 1 cut(s) 47
TseI GCWGC 1 cut(s) 52
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 4 cut(s) 19, 27, 109, 153
XspI CTAG 2 cut(s) 9, 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.