pycom14g11950

Clustered mitochondria protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
15032992 .. 15033302
311 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 219 bp
ATGCCCTTAATATCAACAGGGACTTTAAGATTACTACTTCACAAGACAATACCTTCAGAGCTGAATAAACCGGCATCACATATGCAAACTCTGGAACACAAATATCTTTCAGCCTCGTGTGTTTTTGTTGAGGGGGTGTTAGAAGAAAGTCTTGCTAAGCTTGAGAAAGAGGAGCTAGATTCTGATAATTTTGTGAGATGGGAACTTGGAGCTTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.1

Weight (kDa)

5.22

Isoelectric Point (pI)

58.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 39
AluBI AGCT 4 cut(s) 61, 160, 175, 212
AluI AGCT 4 cut(s) 61, 160, 175, 212
BauI CACGAG 1 cut(s) 115
BccI CCATC 1 cut(s) 192
BfaI CTAG 2 cut(s) 176, 217
BlpI GCTNAGC 1 cut(s) 156
BmsI GCATC 1 cut(s) 83
Bpu1102I GCTNAGC 1 cut(s) 156
BpuEI CTTGAG 1 cut(s) 182
Bse118I RCCGGY 1 cut(s) 70
BseRI GAGGAG 1 cut(s) 185
BsiSI CCGG 1 cut(s) 71
BslFI GGGAC 1 cut(s) 34
BsmFI GGGAC 1 cut(s) 34
Bsp1720I GCTNAGC 1 cut(s) 156
BsrFI RCCGGY 1 cut(s) 70
BssAI RCCGGY 1 cut(s) 70
BssSI CACGAG 1 cut(s) 115
Bst2BI CACGAG 1 cut(s) 115
BstC8I GCNNGC 1 cut(s) 214
BstDEI CTNAG 1 cut(s) 156
Cac8I GCNNGC 1 cut(s) 214
Cfr10I RCCGGY 1 cut(s) 70
CviJI RGCY 5 cut(s) 61, 113, 160, 175, 212
CviKI_1 RGCY 5 cut(s) 61, 113, 160, 175, 212
DdeI CTNAG 1 cut(s) 156
Eco57I CTGAAG 1 cut(s) 39
FaiI YATR 2 cut(s) 81, 83
FalI AAGNNNNNCTT 2 cut(s) 135, 167
FaqI GGGAC 1 cut(s) 34
FauNDI CATATG 1 cut(s) 81
FspBI CTAG 2 cut(s) 176, 217
HapII CCGG 1 cut(s) 71
HindIII AAGCTT 1 cut(s) 158
HinfI GANTC 1 cut(s) 179
HpaII CCGG 1 cut(s) 71
Hpy188I TCNGA 2 cut(s) 58, 184
Hpy188III TCNNGA 1 cut(s) 92
HpyAV CCTTC 1 cut(s) 63
HpyCH4V TGCA 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 156
LmnI GCTCC 2 cut(s) 172, 209
LpnPI CCDG 3 cut(s) 3, 77, 84
LweI GCATC 1 cut(s) 83
MaeI CTAG 2 cut(s) 176, 217
MboII GAAGA 1 cut(s) 155
MluCI AATT 1 cut(s) 187
MnlI CCTC 3 cut(s) 124, 124, 163
MseI TTAA 2 cut(s) 8, 26
MspI CCGG 1 cut(s) 71
NdeI CATATG 1 cut(s) 81
PfeI GAWTC 1 cut(s) 179
SaqAI TTAA 2 cut(s) 8, 26
SetI ASST 5 cut(s) 55, 63, 162, 177, 214
SfaNI GCATC 1 cut(s) 83
SgeI CNNG 9 cut(s) 30, 55, 83, 104, 127, 129, 164, 173, 188
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 1 cut(s) 187
SspMI CTAG 2 cut(s) 176, 217
TasI AATT 1 cut(s) 187
TfiI GAWTC 1 cut(s) 179
Tru1I TTAA 2 cut(s) 8, 26
Tru9I TTAA 2 cut(s) 8, 26
XspI CTAG 2 cut(s) 176, 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.