pycom15g00320

Plays a central role in 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of tRNA(Lys), tRNA(Glu) and tRNA(Gln). Directly binds tRNAs and probably acts by catalyzing adenylation of tRNAs, an intermediate required for 2-thiolation. It is unclear whether it acts as a sulfurtransferase that transfers sulfur from thiocarboxylated URM1 onto the uridine of tRNAs at wobble position

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0005079
Physical Location & Seq
Forward (+)
180270 .. 180611
342 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGCCAGAACAGGGGACATGTGAACGGTGCGGTTACATTTCCAGCCAGAAATGGTGCAAGGCTTGTGTTTTGCTAGAGGGGCTGAATAAGGGTTTGCCAAAGCTGGGAATTGGGCGGAGTCGAGGACTTAATAACGATGGGAAGAATGATACGAAGGAAAGAAATGGAACAAAAAGTATTGAAAGCAAGCAATGTGGGAGTTTGGATTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04122 map04122
Pfam Domains
Protein Families
ATP_bind_3 zn-ribbon_14

Protein Analysis

71

Amino Acids

7.67

Weight (kDa)

8.91

Isoelectric Point (pI)

46.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zn-ribbon_14 PF16503 5 - 35 8.2e-20 Zinc-ribbon
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 30, 115
AfiI CCNNNNNNNGG 2 cut(s) 11, 104
AflIII ACRYGT 1 cut(s) 17
AgsI TTSAA 1 cut(s) 182
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
BccI CCATC 1 cut(s) 131
BfaI CTAG 1 cut(s) 74
Bsc4I CCNNNNNNNGG 2 cut(s) 11, 104
Bse3DI GCAATG 1 cut(s) 197
BseLI CCNNNNNNNGG 2 cut(s) 11, 104
BseMI GCAATG 1 cut(s) 197
BseYI CCCAGC 1 cut(s) 103
BslFI GGGAC 1 cut(s) 28
BslI CCNNNNNNNGG 2 cut(s) 11, 104
BsmFI GGGAC 1 cut(s) 28
BspACI CCGC 2 cut(s) 30, 115
BsrDI GCAATG 1 cut(s) 197
Bst4CI ACNGT 1 cut(s) 27
BstC8I GCNNGC 1 cut(s) 188
BstMWI GCNNNNNNNGC 1 cut(s) 79
BstNSI RCATGY 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 188
CspCI CAANNNNNGTGG 2 cut(s) 175, 210
CviAII CATG 1 cut(s) 18
CviJI RGCY 4 cut(s) 45, 62, 82, 103
CviKI_1 RGCY 4 cut(s) 45, 62, 82, 103
EciI GGCGGA 1 cut(s) 130
FaeI CATG 1 cut(s) 21
FaiI YATR 1 cut(s) 19
FaqI GGGAC 1 cut(s) 28
FatI CATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 74
GsaI CCCAGC 1 cut(s) 107
Hin1II CATG 1 cut(s) 21
HinfI GANTC 1 cut(s) 118
Hpy166II GTNNAC 1 cut(s) 23
Hpy8I GTNNAC 1 cut(s) 23
HpyAV CCTTC 1 cut(s) 148
HpyCH4III ACNGT 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 57
HpyF10VI GCNNNNNNNGC 1 cut(s) 79
Hsp92II CATG 1 cut(s) 21
LpnPI CCDG 4 cut(s) 18, 55, 59, 89
MaeI CTAG 1 cut(s) 74
MaeIII GTNAC 1 cut(s) 32
MboII GAAGA 1 cut(s) 154
MluCI AATT 1 cut(s) 108
MlyI GAGTC 1 cut(s) 127
MnlI CCTC 2 cut(s) 70, 116
MseI TTAA 1 cut(s) 129
MwoI GCNNNNNNNGC 1 cut(s) 79
NlaIII CATG 1 cut(s) 21
NspI RCATGY 1 cut(s) 21
PciI ACATGT 1 cut(s) 17
PleI GAGTC 1 cut(s) 126
PpsI GAGTC 1 cut(s) 126
PscI ACATGT 1 cut(s) 17
PspFI CCCAGC 1 cut(s) 103
SaqAI TTAA 1 cut(s) 129
SchI GAGTC 1 cut(s) 127
SetI ASST 1 cut(s) 105
Sse9I AATT 1 cut(s) 108
SsiI CCGC 2 cut(s) 30, 115
SspMI CTAG 1 cut(s) 74
TaaI ACNGT 1 cut(s) 27
TaqI TCGA 1 cut(s) 121
TasI AATT 1 cut(s) 108
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
XceI RCATGY 1 cut(s) 21
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.