Rmu_sc0004644.1_g000013

Plays a central role in 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of tRNA(Lys), tRNA(Glu) and tRNA(Gln). Directly binds tRNAs and probably acts by catalyzing adenylation of tRNAs, an intermediate required for 2-thiolation. It is unclear whether it acts as a sulfurtransferase that transfers sulfur from thiocarboxylated URM1 onto the uridine of tRNAs at wobble position

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004644.1
Physical Location & Seq
Reverse (-)
93657 .. 94775
1119 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004644.1_g000013.1.cds

Sequence Viewer

Length: 366 bp
ctggattacttctccactgaatgcatttattcaccaaatgcttatcgtggttttgctcgtgagttcatcaaagatttggaaagaatcagacctagggccatacttgacataatcaaatcaggggagaatttcagaatttctactgctacaaaaatgccggaacaggggacatgtgaacgctgtggttacatttcaagccagaaatggtgtaaagcttgtgtattgcttgagggactgaatcggggtttgccaaagatgggaattggtcggaatcgaggaattaacaacactcagaagaaggatatgaaacaaagtaatggaacaaaaagtatagagagcaaacaatgtgggactttggacttctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

121

Amino Acids

13.74

Weight (kDa)

9.36

Isoelectric Point (pI)

40.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 127, 135
AfiI CCNNNNNNNGG 2 cut(s) 164, 257
AflIII ACRYGT 1 cut(s) 170
AgsI TTSAA 1 cut(s) 195
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
AoxI GGCC 1 cut(s) 96
ApoI RAATTY 2 cut(s) 127, 135
AspA2I CCTAGG 1 cut(s) 92
AspS9I GGNCC 1 cut(s) 96
AsuHPI GGTGA 1 cut(s) 24
AvrII CCTAGG 1 cut(s) 92
BauI CACGAG 1 cut(s) 57
BccI CCATC 1 cut(s) 250
BfaI CTAG 1 cut(s) 93
BlnI CCTAGG 1 cut(s) 92
BmgT120I GGNCC 1 cut(s) 96
BpuEI CTTGAG 1 cut(s) 248
BsaJI CCNNGG 1 cut(s) 92
Bsc4I CCNNNNNNNGG 2 cut(s) 164, 257
BseDI CCNNGG 1 cut(s) 92
BseLI CCNNNNNNNGG 2 cut(s) 164, 257
BseMII CTCAG 1 cut(s) 305
BshFI GGCC 1 cut(s) 98
BsiSI CCGG 1 cut(s) 158
BslFI GGGAC 2 cut(s) 181, 246
BslI CCNNNNNNNGG 2 cut(s) 164, 257
BsmFI GGGAC 2 cut(s) 181, 246
BsmI GAATGC 1 cut(s) 26
BsnI GGCC 1 cut(s) 98
BspANI GGCC 1 cut(s) 98
BspCNI CTCAG 1 cut(s) 304
BssECI CCNNGG 1 cut(s) 92
BssSI CACGAG 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 92
Bst2BI CACGAG 1 cut(s) 57
BstDEI CTNAG 1 cut(s) 291
BstNSI RCATGY 1 cut(s) 174
BsuRI GGCC 1 cut(s) 98
BtsIMutI CAGTG 1 cut(s) 15
Cfr13I GGNCC 1 cut(s) 96
CspCI CAANNNNNGTGG 2 cut(s) 328, 363
CviAII CATG 1 cut(s) 171
CviJI RGCY 3 cut(s) 98, 198, 215
CviKI_1 RGCY 3 cut(s) 98, 198, 215
DdeI CTNAG 1 cut(s) 291
Eco130I CCWWGG 1 cut(s) 92
EcoT14I CCWWGG 1 cut(s) 92
EcoT22I ATGCAT 1 cut(s) 26
ErhI CCWWGG 1 cut(s) 92
FaeI CATG 1 cut(s) 174
FaiI YATR 5 cut(s) 101, 110, 172, 305, 332
FaqI GGGAC 2 cut(s) 181, 246
FatI CATG 1 cut(s) 170
FspBI CTAG 1 cut(s) 93
HaeIII GGCC 1 cut(s) 98
HapII CCGG 1 cut(s) 158
Hin1II CATG 1 cut(s) 174
HindIII AAGCTT 1 cut(s) 213
HinfI GANTC 3 cut(s) 84, 238, 271
HpaII CCGG 1 cut(s) 158
HphI GGTGA 1 cut(s) 24
Hpy166II GTNNAC 1 cut(s) 176
Hpy188I TCNGA 5 cut(s) 89, 134, 270, 294, 365
Hpy188III TCNNGA 1 cut(s) 59
Hpy8I GTNNAC 1 cut(s) 176
HpyAV CCTTC 1 cut(s) 292
HpyCH4V TGCA 1 cut(s) 24
HpyF3I CTNAG 1 cut(s) 291
Hsp92II CATG 1 cut(s) 174
LpnPI CCDG 4 cut(s) 105, 149, 171, 212
MaeI CTAG 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 185
MboII GAAGA 1 cut(s) 307
MluCI AATT 4 cut(s) 127, 135, 261, 279
MmeI TCCRAC 1 cut(s) 248
MnlI CCTC 2 cut(s) 223, 269
Mph1103I ATGCAT 1 cut(s) 26
MseI TTAA 1 cut(s) 282
MspI CCGG 1 cut(s) 158
Mva1269I GAATGC 1 cut(s) 26
NlaIII CATG 1 cut(s) 174
NsiI ATGCAT 1 cut(s) 26
NspI RCATGY 1 cut(s) 174
PciI ACATGT 1 cut(s) 170
PctI GAATGC 1 cut(s) 26
PfeI GAWTC 3 cut(s) 84, 238, 271
PscI ACATGT 1 cut(s) 170
PspPI GGNCC 1 cut(s) 96
SaqAI TTAA 1 cut(s) 282
Sau96I GGNCC 1 cut(s) 96
SetI ASST 2 cut(s) 94, 217
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
Sse9I AATT 4 cut(s) 127, 135, 261, 279
SspMI CTAG 1 cut(s) 93
StyI CCWWGG 1 cut(s) 92
TaqI TCGA 1 cut(s) 274
TasI AATT 4 cut(s) 127, 135, 261, 279
TfiI GAWTC 3 cut(s) 84, 238, 271
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TscAI CASTG 1 cut(s) 22
TspDTI ATGAA 2 cut(s) 55, 320
TspRI CASTG 1 cut(s) 22
XapI RAATTY 2 cut(s) 127, 135
XceI RCATGY 1 cut(s) 174
XmaJI CCTAGG 1 cut(s) 92
XspI CTAG 1 cut(s) 93
Zsp2I ATGCAT 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.