RchiOBHm_Chr6g0303951

Plays a central role in 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of tRNA(Lys), tRNA(Glu) and tRNA(Gln). Directly binds tRNAs and probably acts by catalyzing adenylation of tRNAs, an intermediate required for 2-thiolation. It is unclear whether it acts as a sulfurtransferase that transfers sulfur from thiocarboxylated URM1 onto the uridine of tRNAs at wobble position

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
63462518 .. 63464073
1556 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ27306

Sequence Viewer

Length: 390 bp
ATGCATACTTCAAGCGGCTGGATTACTTCTCCACTGAATGCATTTATTCACCAAATGCTTATCGTGGTTTTGCTCGTGAGTTCATCAAAGATTTGGAAAGAATCAGGTCTCCAACCTAGGGCCATACTTGACATAATCAAATCAGGGGAGAATTTCAGAATTTCTACTACTACAAAAATGCCGGAACAGGGGACATGTGAACGCTGTGGTTACATTTCAAGCCAGAAATGGTGTAAAGCTTGTGTATTGCTTGAGGGACTGAATAGGGGTTTGCCAAAGATGGGAATTGGTCGGAATCGAGGAGTTAACAACAATCAGAAGAAGGATATGAAACAAAGTAATGGAGCAAAAAATATAGAGAGCAAACAATGTGGGACTTTGGACTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.33

Weight (kDa)

9.63

Isoelectric Point (pI)

53.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zn-ribbon_14 PF16503 64 - 94 3.6e-19 Zinc-ribbon
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 15
AcsI RAATTY 2 cut(s) 151, 159
AfiI CCNNNNNNNGG 3 cut(s) 118, 188, 281
AflIII ACRYGT 1 cut(s) 194
AgsI TTSAA 2 cut(s) 12, 219
AluBI AGCT 1 cut(s) 239
AluI AGCT 1 cut(s) 239
Alw26I GTCTC 1 cut(s) 113
AoxI GGCC 1 cut(s) 120
ApoI RAATTY 2 cut(s) 151, 159
AspA2I CCTAGG 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 41
AvrII CCTAGG 1 cut(s) 116
BauI CACGAG 1 cut(s) 74
BccI CCATC 1 cut(s) 274
BcoDI GTCTC 1 cut(s) 113
BfaI CTAG 1 cut(s) 117
BisI GCNGC 1 cut(s) 16
BlnI CCTAGG 1 cut(s) 116
BlsI GCNGC 1 cut(s) 17
BmgT120I GGNCC 1 cut(s) 120
BpuEI CTTGAG 1 cut(s) 272
BsaI GGTCTC 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 116
Bsc4I CCNNNNNNNGG 3 cut(s) 118, 188, 281
BseDI CCNNGG 1 cut(s) 116
BseLI CCNNNNNNNGG 3 cut(s) 118, 188, 281
BseRI GAGGAG 1 cut(s) 315
BshFI GGCC 1 cut(s) 122
BsiSI CCGG 1 cut(s) 182
BslFI GGGAC 2 cut(s) 205, 270
BslI CCNNNNNNNGG 3 cut(s) 118, 188, 281
BsmAI GTCTC 1 cut(s) 113
BsmFI GGGAC 2 cut(s) 205, 270
BsmI GAATGC 1 cut(s) 43
BsnI GGCC 1 cut(s) 122
Bso31I GGTCTC 1 cut(s) 113
BspACI CCGC 1 cut(s) 15
BspANI GGCC 1 cut(s) 122
BspTNI GGTCTC 1 cut(s) 113
BssECI CCNNGG 1 cut(s) 116
BssSI CACGAG 1 cut(s) 74
BssT1I CCWWGG 1 cut(s) 116
Bst2BI CACGAG 1 cut(s) 74
BstMAI GTCTC 1 cut(s) 113
BstNSI RCATGY 1 cut(s) 198
BsuRI GGCC 1 cut(s) 122
BtsIMutI CAGTG 1 cut(s) 32
Cfr13I GGNCC 1 cut(s) 120
CspCI CAANNNNNGTGG 2 cut(s) 352, 387
CviAII CATG 1 cut(s) 195
CviJI RGCY 4 cut(s) 18, 122, 222, 239
CviKI_1 RGCY 4 cut(s) 18, 122, 222, 239
Eco130I CCWWGG 1 cut(s) 116
Eco31I GGTCTC 1 cut(s) 113
EcoT14I CCWWGG 1 cut(s) 116
EcoT22I ATGCAT 2 cut(s) 6, 43
ErhI CCWWGG 1 cut(s) 116
FaeI CATG 1 cut(s) 198
FaiI YATR 6 cut(s) 6, 125, 134, 196, 329, 356
FaqI GGGAC 2 cut(s) 205, 270
FatI CATG 1 cut(s) 194
Fnu4HI GCNGC 1 cut(s) 16
Fsp4HI GCNGC 1 cut(s) 16
FspBI CTAG 1 cut(s) 117
GluI GCNGC 1 cut(s) 16
HaeIII GGCC 1 cut(s) 122
HapII CCGG 1 cut(s) 182
Hin1II CATG 1 cut(s) 198
HincII GTYRAC 1 cut(s) 307
HindII GTYRAC 1 cut(s) 307
HindIII AAGCTT 1 cut(s) 237
HinfI GANTC 2 cut(s) 101, 295
HpaI GTTAAC 1 cut(s) 307
HpaII CCGG 1 cut(s) 182
HphI GGTGA 1 cut(s) 41
Hpy166II GTNNAC 2 cut(s) 200, 307
Hpy188I TCNGA 4 cut(s) 158, 294, 318, 389
Hpy188III TCNNGA 1 cut(s) 76
Hpy8I GTNNAC 2 cut(s) 200, 307
HpyAV CCTTC 1 cut(s) 316
HpyCH4V TGCA 2 cut(s) 4, 41
Hsp92II CATG 1 cut(s) 198
KspAI GTTAAC 1 cut(s) 307
LmnI GCTCC 1 cut(s) 344
LpnPI CCDG 6 cut(s) 4, 90, 129, 173, 195, 236
MaeI CTAG 1 cut(s) 117
MaeIII GTNAC 1 cut(s) 209
MboII GAAGA 1 cut(s) 331
MluCI AATT 3 cut(s) 151, 159, 285
MmeI TCCRAC 2 cut(s) 136, 272
MnlI CCTC 2 cut(s) 247, 293
Mph1103I ATGCAT 2 cut(s) 6, 43
MseI TTAA 1 cut(s) 306
MspI CCGG 1 cut(s) 182
Mva1269I GAATGC 1 cut(s) 43
NlaIII CATG 1 cut(s) 198
NsiI ATGCAT 2 cut(s) 6, 43
NspI RCATGY 1 cut(s) 198
PciI ACATGT 1 cut(s) 194
PctI GAATGC 1 cut(s) 43
PfeI GAWTC 2 cut(s) 101, 295
PkrI GCNGC 1 cut(s) 17
PscI ACATGT 1 cut(s) 194
PspPI GGNCC 1 cut(s) 120
SaqAI TTAA 1 cut(s) 306
SatI GCNGC 1 cut(s) 16
Sau96I GGNCC 1 cut(s) 120
SetI ASST 3 cut(s) 109, 118, 241
SmlI CTYRAG 1 cut(s) 251
SmoI CTYRAG 1 cut(s) 251
Sse9I AATT 3 cut(s) 151, 159, 285
SsiI CCGC 1 cut(s) 15
SspMI CTAG 1 cut(s) 117
StyI CCWWGG 1 cut(s) 116
TaqI TCGA 1 cut(s) 298
TasI AATT 3 cut(s) 151, 159, 285
TauI GCSGC 1 cut(s) 18
TfiI GAWTC 2 cut(s) 101, 295
Tru1I TTAA 1 cut(s) 306
Tru9I TTAA 1 cut(s) 306
TscAI CASTG 1 cut(s) 39
TspDTI ATGAA 2 cut(s) 72, 344
TspRI CASTG 1 cut(s) 39
XapI RAATTY 2 cut(s) 151, 159
XceI RCATGY 1 cut(s) 198
XmaJI CCTAGG 1 cut(s) 116
XspI CTAG 1 cut(s) 117
Zsp2I ATGCAT 2 cut(s) 6, 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.