pycom16g13330

Belongs to the endosulfine family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
9485329 .. 9488309
2981 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 297 bp
ATGAGATATGCATTTCTCAAATCAAAATTAAATACTAAAATACAAGACAGAGAAATAAATACAAATACATTCTTATCTTACCTCTCACTCAACCCTCATTCCTCGTCTCTCTCTTTCTTTTTATCCTTTGGTTCCCTTTTGCATCTCTCACTTTGCTCATCCACAAGGAGAGCCAAGATGGAGGATTGCAACAGAGGCCAAGACTATTTCTCTGCCCAAGACCATGAGGCAACATCTGCCAACAAATATGGAGGCCTTGCGCCAAAGAAGAAGCCTTTGATTTCAAAGGATCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.12

Weight (kDa)

9.7

Isoelectric Point (pI)

31.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011376)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 285
Alw26I GTCTC 1 cut(s) 111
AoxI GGCC 2 cut(s) 196, 253
AspLEI GCGC 1 cut(s) 262
BccI CCATC 1 cut(s) 172
BcoDI GTCTC 1 cut(s) 111
BmiI GGNNCC 1 cut(s) 133
BmsI GCATC 1 cut(s) 151
Bsa29I ATCGAT 1 cut(s) 292
BseCI ATCGAT 1 cut(s) 292
BseGI GGATG 1 cut(s) 158
BshFI GGCC 2 cut(s) 198, 255
BshVI ATCGAT 1 cut(s) 292
BsmAI GTCTC 1 cut(s) 111
BsmBI CGTCTC 1 cut(s) 111
BsnI GGCC 2 cut(s) 198, 255
Bsp143I GATC 1 cut(s) 289
BspANI GGCC 2 cut(s) 198, 255
BspDI ATCGAT 1 cut(s) 292
BspLI GGNNCC 1 cut(s) 133
BssMI GATC 1 cut(s) 289
BstAPI GCANNNNNTGC 1 cut(s) 236
BstF5I GGATG 1 cut(s) 158
BstHHI GCGC 1 cut(s) 262
BstKTI GATC 1 cut(s) 292
BstMAI GTCTC 1 cut(s) 111
BstMBI GATC 1 cut(s) 289
BstMWI GCNNNNNNNGC 2 cut(s) 195, 236
Bsu15I ATCGAT 1 cut(s) 292
BsuRI GGCC 2 cut(s) 198, 255
BsuTUI ATCGAT 1 cut(s) 292
BtsCI GGATG 1 cut(s) 158
CfoI GCGC 1 cut(s) 262
ClaI ATCGAT 1 cut(s) 292
CviAII CATG 1 cut(s) 224
CviJI RGCY 4 cut(s) 173, 198, 255, 274
CviKI_1 RGCY 4 cut(s) 173, 198, 255, 274
DpnI GATC 1 cut(s) 291
DpnII GATC 1 cut(s) 289
Eco147I AGGCCT 1 cut(s) 255
EcoT22I ATGCAT 1 cut(s) 13
Esp3I CGTCTC 1 cut(s) 111
FaeI CATG 1 cut(s) 227
FaiI YATR 3 cut(s) 9, 225, 249
FatI CATG 1 cut(s) 223
FokI GGATG 1 cut(s) 145
GlaI GCGC 1 cut(s) 261
HaeIII GGCC 2 cut(s) 198, 255
HhaI GCGC 1 cut(s) 262
Hin1II CATG 1 cut(s) 227
Hin6I GCGC 1 cut(s) 260
HinP1I GCGC 1 cut(s) 260
HpyCH4V TGCA 3 cut(s) 11, 142, 189
HpyF10VI GCNNNNNNNGC 2 cut(s) 195, 236
Hsp92II CATG 1 cut(s) 227
HspAI GCGC 1 cut(s) 260
Kzo9I GATC 1 cut(s) 289
LweI GCATC 1 cut(s) 151
MalI GATC 1 cut(s) 291
MboI GATC 1 cut(s) 289
MboII GAAGA 1 cut(s) 280
MluCI AATT 1 cut(s) 26
MnlI CCTC 7 cut(s) 92, 105, 112, 175, 188, 220, 245
Mph1103I ATGCAT 1 cut(s) 13
MseI TTAA 1 cut(s) 29
MwoI GCNNNNNNNGC 2 cut(s) 195, 236
NdeII GATC 1 cut(s) 289
NlaIII CATG 1 cut(s) 227
NlaIV GGNNCC 1 cut(s) 133
NsiI ATGCAT 1 cut(s) 13
PceI AGGCCT 1 cut(s) 255
PspN4I GGNNCC 1 cut(s) 133
SaqAI TTAA 1 cut(s) 29
Sau3AI GATC 1 cut(s) 289
SetI ASST 1 cut(s) 84
SfaNI GCATC 1 cut(s) 151
SgeI CNNG 8 cut(s) 56, 115, 177, 187, 212, 230, 236, 269
Sse9I AATT 1 cut(s) 26
SseBI AGGCCT 1 cut(s) 255
StuI AGGCCT 1 cut(s) 255
TaqI TCGA 1 cut(s) 292
TasI AATT 1 cut(s) 26
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
Zsp2I ATGCAT 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.