pycom16g18860

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
15633334 .. 15633818
485 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 315 bp
ATGAGAATGATGAATCTTCAGAGTGTTAGTGTCTATCAAGCAGATAAGATTCAGAAAGAAAACTCCACATCTGTTGCCATAATAGCGTTGATGCTTTATATGATATGTTTTGGGCTATTTTTTAAGGAAAGAGGGATGCTTAAGGAAGCAACTTTGGAGAAAAGAGCTCATGCGCCACTAAAGAAGATCACATTAGTCAGGACTCCAGGGGCAAATTCAACAAGCAAACATCAGAACGTGATACAGGTATTTACGCATGAATCTGAACAATTACTTTGTGTATCACTGTCATATAGGCAAATTTGTTATGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

11.9

Weight (kDa)

9.47

Isoelectric Point (pI)

20.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 214, 300
AflII CTTAAG 1 cut(s) 140
AgsI TTSAA 1 cut(s) 219
AjnI CCWGG 1 cut(s) 205
AluBI AGCT 1 cut(s) 167
AluI AGCT 1 cut(s) 167
Alw21I GWGCWC 1 cut(s) 169
ApoI RAATTY 2 cut(s) 214, 300
AspLEI GCGC 1 cut(s) 175
BanII GRGCYC 1 cut(s) 169
Bbv12I GWGCWC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 207
BfrI CTTAAG 1 cut(s) 140
Bme1390I CCNGG 1 cut(s) 207
BmrFI CCNGG 1 cut(s) 207
BmsI GCATC 2 cut(s) 81, 126
BpmI CTGGAG 1 cut(s) 189
BsaJI CCNNGG 1 cut(s) 206
BseBI CCWGG 1 cut(s) 207
BseDI CCNNGG 1 cut(s) 206
BseGI GGATG 1 cut(s) 141
BsiHKAI GWGCWC 1 cut(s) 169
Bsp1286I GDGCHC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 186
BspTI CTTAAG 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 206
BssMI GATC 1 cut(s) 186
Bst2UI CCWGG 1 cut(s) 207
Bst4CI ACNGT 1 cut(s) 288
BstAFI CTTAAG 1 cut(s) 140
BstF5I GGATG 1 cut(s) 141
BstHHI GCGC 1 cut(s) 175
BstKTI GATC 1 cut(s) 189
BstMBI GATC 1 cut(s) 186
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstNI CCWGG 1 cut(s) 207
BstSCI CCNGG 1 cut(s) 205
BtsCI GGATG 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 284
CfoI GCGC 1 cut(s) 175
CspCI CAANNNNNGTGG 2 cut(s) 55, 90
CviAII CATG 2 cut(s) 170, 257
CviJI RGCY 2 cut(s) 115, 167
CviKI_1 RGCY 2 cut(s) 115, 167
DpnI GATC 1 cut(s) 188
DpnII GATC 1 cut(s) 186
Ecl136II GAGCTC 1 cut(s) 167
Eco24I GRGCYC 1 cut(s) 169
Eco53kI GAGCTC 1 cut(s) 167
EcoICRI GAGCTC 1 cut(s) 167
EcoRII CCWGG 1 cut(s) 205
EcoT38I GRGCYC 1 cut(s) 169
FaeI CATG 2 cut(s) 173, 260
FaiI YATR 9 cut(s) 80, 99, 101, 106, 171, 258, 292, 294, 309
FatI CATG 2 cut(s) 169, 256
FokI GGATG 1 cut(s) 148
FriOI GRGCYC 1 cut(s) 169
GlaI GCGC 1 cut(s) 174
GsuI CTGGAG 1 cut(s) 189
HhaI GCGC 1 cut(s) 175
Hin1II CATG 2 cut(s) 173, 260
Hin6I GCGC 1 cut(s) 173
HinP1I GCGC 1 cut(s) 173
HinfI GANTC 4 cut(s) 13, 49, 202, 260
Hpy188I TCNGA 4 cut(s) 21, 54, 234, 265
Hpy188III TCNNGA 1 cut(s) 199
HpyCH4III ACNGT 1 cut(s) 288
HpyCH4IV ACGT 1 cut(s) 237
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpySE526I ACGT 1 cut(s) 237
Hsp92II CATG 2 cut(s) 173, 260
HspAI GCGC 1 cut(s) 173
Kzo9I GATC 1 cut(s) 186
LpnPI CCDG 4 cut(s) 184, 192, 219, 230
LweI GCATC 2 cut(s) 81, 126
MaeII ACGT 1 cut(s) 237
MalI GATC 1 cut(s) 188
MboI GATC 1 cut(s) 186
MboII GAAGA 2 cut(s) 8, 196
MhlI GDGCHC 1 cut(s) 169
MluCI AATT 3 cut(s) 214, 269, 300
MlyI GAGTC 1 cut(s) 196
MnlI CCTC 1 cut(s) 125
MseI TTAA 2 cut(s) 123, 141
MspCI CTTAAG 1 cut(s) 140
MspR9I CCNGG 1 cut(s) 207
MvaI CCWGG 1 cut(s) 207
MwoI GCNNNNNNNGC 1 cut(s) 83
NdeII GATC 1 cut(s) 186
NlaIII CATG 2 cut(s) 173, 260
PfeI GAWTC 3 cut(s) 13, 49, 260
PleI GAGTC 1 cut(s) 196
PpsI GAGTC 1 cut(s) 196
Psp124BI GAGCTC 1 cut(s) 169
Psp6I CCWGG 1 cut(s) 205
PspGI CCWGG 1 cut(s) 205
SacI GAGCTC 1 cut(s) 169
SaqAI TTAA 2 cut(s) 123, 141
Sau3AI GATC 1 cut(s) 186
SchI GAGTC 1 cut(s) 196
ScrFI CCNGG 1 cut(s) 207
SduI GDGCHC 1 cut(s) 169
SetI ASST 3 cut(s) 169, 240, 249
SfaNI GCATC 2 cut(s) 81, 126
SgeI CNNG 9 cut(s) 50, 182, 211, 218, 219, 234, 250, 257, 269
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
Sse9I AATT 3 cut(s) 214, 269, 300
SstI GAGCTC 1 cut(s) 169
StyD4I CCNGG 1 cut(s) 205
TaaI ACNGT 1 cut(s) 288
TaiI ACGT 1 cut(s) 240
TasI AATT 3 cut(s) 214, 269, 300
TfiI GAWTC 3 cut(s) 13, 49, 260
Tru1I TTAA 2 cut(s) 123, 141
Tru9I TTAA 2 cut(s) 123, 141
TscAI CASTG 1 cut(s) 291
TspDTI ATGAA 2 cut(s) 26, 273
TspRI CASTG 1 cut(s) 291
Vha464I CTTAAG 1 cut(s) 140
XapI RAATTY 2 cut(s) 214, 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.