RLG00000000929

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Forward (+)
8117867 .. 8118520
654 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000000929

Sequence Viewer

Length: 654 bp
ATGACCCACTTGTATCTCTCTCAAAATCAGCTTTCTGGTGCCATTCCTCCAGAAATGGGCAACCTATCCAATTTAGTTCTATTGTTCATGGATGACAACCATTTGACTGGTCCCATCCCACATTTGATCAGTTCCATCTCCAAACTCATCCATCTTAATCCATCTTATAATCTGATCAATGAGACAATCCCACCAGAAATTGGCCTTCTATCAAATCTTGAAACTCTGCACCTAGATGCAAATCAGTTCAGTGGCTCAATTCCCAAAGAAATAGGCCAACTCAAGTATCTTTACGAGCTTAGTCTGGGCATCAACAATCTAGAAGGGTCTATTCCGGCTTCTCTGGGTAATTTCACCAACATGACCTACTTGTGTCTCCATCAAAATCAGCTTTCTGGTGCCATTCCTCCAGAGATAGGAAATCTATCTAGTTTGATCCACCTGGTCATGTATGACAACCATTTGATAGGTCCCATCCCTCCAAGTTTTGGAAACTTGAAGAACTTAGTTTTACTATTCTTGCAATTGAATCAACTGTCTGGCCTTATTCCCTGTGAGATTAGGAATCTGAAATCCATTCAAATGTTGGATGTTGTCAACAATCATCTTTCTGGCCTCATTCCCAGTGACATAGGGAATATGAAATCCCTTTAG

Protein Analysis

218

Amino Acids

23.77

Weight (kDa)

5.45

Isoelectric Point (pI)

21.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 5 - 106 1.3e-06 Leucine-rich repeat region
LRR_14 PF23598 46 - 128 1e-06 Leucine-rich repeat region
LRR_14 PF23598 113 - 217 8.6e-10 Leucine-rich repeat region
LRR_8 PF13855 162 - 203 6.5e-06 Leucine rich repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 168
AccB1I GGYRCC 2 cut(s) 38, 398
AccB7I CCANNNNNTGG 2 cut(s) 200, 488
AclWI GGATC 1 cut(s) 430
AfiI CCNNNNNNNGG 4 cut(s) 56, 200, 416, 488
AgsI TTSAA 4 cut(s) 221, 499, 529, 581
AjnI CCWGG 1 cut(s) 441
AluBI AGCT 3 cut(s) 31, 298, 391
AluI AGCT 3 cut(s) 31, 298, 391
Alw26I GTCTC 2 cut(s) 176, 380
AlwI GGATC 1 cut(s) 430
AoxI GGCC 4 cut(s) 202, 274, 541, 613
AspS9I GGNCC 2 cut(s) 110, 470
AsuHPI GGTGA 1 cut(s) 346
AvaII GGWCC 2 cut(s) 110, 470
BaeI ACNNNNGTAYC 2 cut(s) 269, 302
BanI GGYRCC 2 cut(s) 38, 398
BccI CCATC 6 cut(s) 122, 143, 159, 169, 387, 482
BciT130I CCWGG 1 cut(s) 443
BclI TGATCA 2 cut(s) 126, 174
BcoDI GTCTC 2 cut(s) 176, 380
BfaI CTAG 3 cut(s) 233, 320, 429
Bme1390I CCNGG 1 cut(s) 443
Bme18I GGWCC 2 cut(s) 110, 470
BmgT120I GGNCC 2 cut(s) 110, 470
BmiI GGNNCC 4 cut(s) 40, 112, 400, 472
BmrFI CCNGG 1 cut(s) 443
BmrI ACTGGG 1 cut(s) 618
BmsI GCATC 2 cut(s) 226, 318
BmuI ACTGGG 1 cut(s) 618
BpmI CTGGAG 2 cut(s) 33, 393
BpuEI CTTGAG 1 cut(s) 266
BsaBI GATNNNNATC 1 cut(s) 240
Bsc4I CCNNNNNNNGG 4 cut(s) 56, 200, 416, 488
Bse1I ACTGG 2 cut(s) 112, 624
Bse8I GATNNNNATC 1 cut(s) 240
BseBI CCWGG 1 cut(s) 443
BseGI GGATG 5 cut(s) 97, 114, 147, 474, 595
BseJI GATNNNNATC 1 cut(s) 240
BseLI CCNNNNNNNGG 4 cut(s) 56, 200, 416, 488
BseNI ACTGG 2 cut(s) 112, 624
BsgI GTGCAG 1 cut(s) 212
BshFI GGCC 4 cut(s) 204, 276, 543, 615
BshNI GGYRCC 2 cut(s) 38, 398
BsiSI CCGG 1 cut(s) 335
BslFI GGGAC 2 cut(s) 96, 456
BslI CCNNNNNNNGG 4 cut(s) 56, 200, 416, 488
BsmAI GTCTC 2 cut(s) 176, 380
BsmFI GGGAC 2 cut(s) 96, 456
BsnI GGCC 4 cut(s) 204, 276, 543, 615
Bsp143I GATC 3 cut(s) 126, 174, 435
BspANI GGCC 4 cut(s) 204, 276, 543, 615
BspLI GGNNCC 4 cut(s) 40, 112, 400, 472
BspPI GGATC 1 cut(s) 430
BspT107I GGYRCC 2 cut(s) 38, 398
BsrI ACTGG 2 cut(s) 112, 624
BssMI GATC 3 cut(s) 126, 174, 435
Bst2UI CCWGG 1 cut(s) 443
Bst4CI ACNGT 1 cut(s) 537
BstDEI CTNAG 2 cut(s) 299, 505
BstF5I GGATG 5 cut(s) 97, 114, 147, 474, 595
BstKTI GATC 3 cut(s) 129, 177, 438
BstMAI GTCTC 2 cut(s) 176, 380
BstMBI GATC 3 cut(s) 126, 174, 435
BstNI CCWGG 1 cut(s) 443
BstSCI CCNGG 1 cut(s) 441
BstXI CCANNNNNNTGG 1 cut(s) 107
BsuRI GGCC 4 cut(s) 204, 276, 543, 615
BtsCI GGATG 5 cut(s) 97, 114, 147, 474, 595
BtsIMutI CAGTG 2 cut(s) 256, 631
Cfr13I GGNCC 2 cut(s) 110, 470
CsiI ACCWGGT 1 cut(s) 441
CviAII CATG 3 cut(s) 88, 361, 448
CviJI RGCY 9 cut(s) 31, 204, 255, 276, 298, 338, 391, 543, 615
CviKI_1 RGCY 9 cut(s) 31, 204, 255, 276, 298, 338, 391, 543, 615
DdeI CTNAG 2 cut(s) 299, 505
DpnI GATC 3 cut(s) 128, 176, 437
DpnII GATC 3 cut(s) 126, 174, 435
Eco47I GGWCC 2 cut(s) 110, 470
EcoO109I RGGNCCY 1 cut(s) 470
EcoRII CCWGG 1 cut(s) 441
FaeI CATG 3 cut(s) 91, 364, 451
FaiI YATR 7 cut(s) 89, 168, 362, 449, 453, 632, 641
FaqI GGGAC 2 cut(s) 96, 456
FatI CATG 3 cut(s) 87, 360, 447
FbaI TGATCA 2 cut(s) 126, 174
FokI GGATG 5 cut(s) 101, 104, 134, 461, 602
FspBI CTAG 3 cut(s) 233, 320, 429
GsuI CTGGAG 2 cut(s) 33, 393
HaeIII GGCC 4 cut(s) 204, 276, 543, 615
HapII CCGG 1 cut(s) 335
Hin1II CATG 3 cut(s) 91, 364, 451
HincII GTYRAC 1 cut(s) 598
HindII GTYRAC 1 cut(s) 598
HinfI GANTC 2 cut(s) 529, 565
HpaII CCGG 1 cut(s) 335
HphI GGTGA 1 cut(s) 346
Hpy166II GTNNAC 1 cut(s) 598
Hpy188I TCNGA 2 cut(s) 174, 570
Hpy188III TCNNGA 4 cut(s) 50, 218, 320, 410
Hpy8I GTNNAC 1 cut(s) 598
HpyAV CCTTC 2 cut(s) 215, 317
HpyCH4III ACNGT 1 cut(s) 537
HpyCH4V TGCA 3 cut(s) 229, 239, 523
HpyF3I CTNAG 2 cut(s) 299, 505
Hsp92II CATG 3 cut(s) 91, 364, 451
Ksp22I TGATCA 2 cut(s) 126, 174
Kzo9I GATC 3 cut(s) 126, 174, 435
LweI GCATC 2 cut(s) 226, 318
MabI ACCWGGT 1 cut(s) 441
MaeI CTAG 3 cut(s) 233, 320, 429
MaeIII GTNAC 1 cut(s) 626
MalI GATC 3 cut(s) 128, 176, 437
MboI GATC 3 cut(s) 126, 174, 435
MboII GAAGA 1 cut(s) 511
MfeI CAATTG 1 cut(s) 524
MluCI AATT 5 cut(s) 70, 198, 258, 349, 524
MmeI TCCRAC 1 cut(s) 567
MnlI CCTC 4 cut(s) 57, 417, 489, 626
MseI TTAA 1 cut(s) 156
MslI CAYNNNNRTG 3 cut(s) 234, 359, 581
MspI CCGG 1 cut(s) 335
MspR9I CCNGG 1 cut(s) 443
MunI CAATTG 1 cut(s) 524
MvaI CCWGG 1 cut(s) 443
NdeII GATC 3 cut(s) 126, 174, 435
NlaIII CATG 3 cut(s) 91, 364, 451
NlaIV GGNNCC 4 cut(s) 40, 112, 400, 472
NmuCI GTSAC 1 cut(s) 626
PfeI GAWTC 2 cut(s) 529, 565
PflMI CCANNNNNTGG 2 cut(s) 200, 488
PpuMI RGGWCCY 1 cut(s) 470
PsiI TTATAA 1 cut(s) 168
Psp5II RGGWCCY 1 cut(s) 470
Psp6I CCWGG 1 cut(s) 441
PspGI CCWGG 1 cut(s) 441
PspN4I GGNNCC 4 cut(s) 40, 112, 400, 472
PspPI GGNCC 2 cut(s) 110, 470
PspPPI RGGWCCY 1 cut(s) 470
RseI CAYNNNNRTG 3 cut(s) 234, 359, 581
SaqAI TTAA 1 cut(s) 156
Sau3AI GATC 3 cut(s) 126, 174, 435
Sau96I GGNCC 2 cut(s) 110, 470
ScrFI CCNGG 1 cut(s) 443
SetI ASST 8 cut(s) 33, 66, 234, 300, 368, 393, 444, 472
SexAI ACCWGGT 1 cut(s) 441
SfaNI GCATC 2 cut(s) 226, 318
SinI GGWCC 2 cut(s) 110, 470
SmiMI CAYNNNNRTG 3 cut(s) 234, 359, 581
SmlI CTYRAG 1 cut(s) 281
SmoI CTYRAG 1 cut(s) 281
Sse9I AATT 5 cut(s) 70, 198, 258, 349, 524
SspMI CTAG 3 cut(s) 233, 320, 429
StyD4I CCNGG 1 cut(s) 441
TaaI ACNGT 1 cut(s) 537
TasI AATT 5 cut(s) 70, 198, 258, 349, 524
TfiI GAWTC 2 cut(s) 529, 565
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TscAI CASTG 2 cut(s) 256, 631
TseFI GTSAC 1 cut(s) 626
Tsp45I GTSAC 1 cut(s) 626
TspDTI ATGAA 1 cut(s) 76
TspRI CASTG 2 cut(s) 256, 631
Van91I CCANNNNNTGG 2 cut(s) 200, 488
VpaK11BI GGWCC 2 cut(s) 110, 470
XbaI TCTAGA 1 cut(s) 319
XcmI CCANNNNNNNNNTGG 1 cut(s) 583
XspI CTAG 3 cut(s) 233, 320, 429
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.