Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0008933

Physical Location & Seq

Genomic Coordinates Forward (+)

6249491 .. 6251346

Gene Structure 1856 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 411 bp

ATGGCAAGTTCTACTTCTACTGAAACAAAGAGTTCGTGGCCGGAGCTAGTTGGTACCAAAGGCGAGGAAGCAGCAGCCACCATAATCAAAGAAAACCCTTCTGTCAAAGCCCATACAGTAAACGAAGGATCTTTTGTCACCTTCGATATGCGTCGCGACAGAGTTCGGGTCTGGATTGATGAGCGTGGGATTGTCACTAAGGCGCCTAAGATTGAAACAAAGAGTTCGTGGCCAGAGTTAGTTGGAACCAAAGGAGAGGAAGCAGCAGCCACCATAATCAAAGAAAACCCCTCTGTCAAAGCCCATACAGTAAACGAAGGATCCCTCGTCACCTGTGATATACGTCATGACAGAGTTCGTGTCTGGATTGATGAGCGTGGGGTCGTCACTGAGGCCCCTAAGATTGGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

potato_inhibit

Protein Analysis

136

Amino Acids

14.94

Weight (kDa)

6.32

Isoelectric Point (pI)

25.81

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
potato_inhibit	PF00280	10 - 71	3.9e-23	Potato inhibitor I family
potato_inhibit	PF00280	74 - 136	2.9e-23	Potato inhibitor I family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008933)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G38870 AT2G38900 AT2G38900
fragaria_vesca	FvH4_4g02940 FvH4_4g02940
malus_domestica	MD05G1203000.v1.1 MD13G1208800.v1.1
prunus_persica	Prupe.1G032900_v2.0.a1 Prupe.8G228900_v2.0.a1 Prupe.8G229000_v2.0.a1 Prupe.8G229400_v2.0.a1
pyrus_communis	pycom10g16380
rosa_chinensis	RchiOBHm_Chr4g0391001
rosa_multiflora	Rmu_sc0001824.1_g000013 Rmu_sc0016732.1_g000002
rosa_roxburghii	Rroxscaffold_5G00336840
rosa_rugosa	Rorug03G0332600
rosa_samantha	Rh4AG034100 Rh4BG028600 Rh4CG037500 Rh4DG031400
rosa_wichuraiana	Rw4G002650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	53
AccB1I	GGYRCC	2 cut(s)	53, 202
AccII	CGCG	1 cut(s)	156
AclWI	GGATC	3 cut(s)	136, 315, 328
AcoI	YGGCCR	2 cut(s)	38, 230
AcyI	GRCGYC	1 cut(s)	203
AfaI	GTAC	1 cut(s)	55
AfiI	CCNNNNNNNGG	1 cut(s)	404
AgsI	TTSAA	1 cut(s)	215
AluBI	AGCT	1 cut(s)	46
AluI	AGCT	1 cut(s)	46
AlwI	GGATC	3 cut(s)	136, 315, 328
AoxI	GGCC	3 cut(s)	38, 230, 393
ApeKI	GCWGC	4 cut(s)	71, 74, 263, 266
Asp718I	GGTACC	1 cut(s)	53
AspLEI	GCGC	1 cut(s)	205
AspS9I	GGNCC	1 cut(s)	394
AsuHPI	GGTGA	2 cut(s)	130, 322
BalI	TGGCCA	1 cut(s)	232
BamHI	GGATCC	1 cut(s)	320
BanI	GGYRCC	2 cut(s)	53, 202
BbvI	GCAGC	4 cut(s)	83, 86, 275, 278
BfaI	CTAG	1 cut(s)	47
BfoI	RGCGCY	1 cut(s)	206
BisI	GCNGC	4 cut(s)	72, 75, 264, 267
BlsI	GCNGC	4 cut(s)	73, 76, 265, 268
BmgT120I	GGNCC	1 cut(s)	394
BmiI	GGNNCC	5 cut(s)	55, 204, 247, 322, 396
BsaHI	GRCGYC	1 cut(s)	203
Bsc4I	CCNNNNNNNGG	1 cut(s)	404
BseLI	CCNNNNNNNGG	1 cut(s)	404
BseMII	CTCAG	1 cut(s)	381
BseXI	GCAGC	4 cut(s)	83, 86, 275, 278
Bsh1236I	CGCG	1 cut(s)	156
BshFI	GGCC	3 cut(s)	40, 232, 395
BshNI	GGYRCC	2 cut(s)	53, 202
BsiSI	CCGG	1 cut(s)	41
BslI	CCNNNNNNNGG	1 cut(s)	404
BsnI	GGCC	3 cut(s)	40, 232, 395
Bsp143I	GATC	2 cut(s)	128, 320
Bsp68I	TCGCGA	1 cut(s)	156
BspANI	GGCC	3 cut(s)	40, 232, 395
BspCNI	CTCAG	1 cut(s)	382
BspFNI	CGCG	1 cut(s)	156
BspHI	TCATGA	1 cut(s)	346
BspLI	GGNNCC	5 cut(s)	55, 204, 247, 322, 396
BspPI	GGATC	3 cut(s)	136, 315, 328
BspT107I	GGYRCC	2 cut(s)	53, 202
BssMI	GATC	2 cut(s)	128, 320
BssNI	GRCGYC	1 cut(s)	203
Bst4CI	ACNGT	2 cut(s)	118, 310
BstACI	GRCGYC	1 cut(s)	203
BstDEI	CTNAG	4 cut(s)	198, 207, 390, 399
BstFNI	CGCG	1 cut(s)	156
BstH2I	RGCGCY	1 cut(s)	206
BstHHI	GCGC	1 cut(s)	205
BstKTI	GATC	2 cut(s)	131, 323
BstMBI	GATC	2 cut(s)	128, 320
BstUI	CGCG	1 cut(s)	156
BstV1I	GCAGC	4 cut(s)	83, 86, 275, 278
BstX2I	RGATCY	2 cut(s)	128, 320
BstYI	RGATCY	2 cut(s)	128, 320
BsuRI	GGCC	3 cut(s)	40, 232, 395
BtsIMutI	CAGTG	1 cut(s)	387
BtuMI	TCGCGA	1 cut(s)	156
CciI	TCATGA	1 cut(s)	346
CfoI	GCGC	1 cut(s)	205
Cfr13I	GGNCC	1 cut(s)	394
CseI	GACGC	1 cut(s)	140
Csp6I	GTAC	1 cut(s)	54
CviAII	CATG	1 cut(s)	347
CviJI	RGCY	8 cut(s)	40, 46, 77, 110, 232, 269, 302, 395
CviKI_1	RGCY	8 cut(s)	40, 46, 77, 110, 232, 269, 302, 395
CviQI	GTAC	1 cut(s)	54
DdeI	CTNAG	4 cut(s)	198, 207, 390, 399
DinI	GGCGCC	1 cut(s)	204
DpnI	GATC	2 cut(s)	130, 322
DpnII	GATC	2 cut(s)	128, 320
EaeI	YGGCCR	2 cut(s)	38, 230
EcoO109I	RGGNCCY	1 cut(s)	394
EgeI	GGCGCC	1 cut(s)	204
EheI	GGCGCC	1 cut(s)	204
FaeI	CATG	1 cut(s)	350
FaiI	YATR	7 cut(s)	83, 114, 149, 275, 306, 341, 348
FalI	AAGNNNNNCTT	1 cut(s)	30
FatI	CATG	1 cut(s)	346
Fnu4HI	GCNGC	4 cut(s)	72, 75, 264, 267
Fsp4HI	GCNGC	4 cut(s)	72, 75, 264, 267
FspBI	CTAG	1 cut(s)	47
GlaI	GCGC	1 cut(s)	204
GluI	GCNGC	4 cut(s)	72, 75, 264, 267
HaeII	RGCGCY	1 cut(s)	206
HaeIII	GGCC	3 cut(s)	40, 232, 395
HapII	CCGG	1 cut(s)	41
HgaI	GACGC	1 cut(s)	140
HhaI	GCGC	1 cut(s)	205
Hin1I	GRCGYC	1 cut(s)	203
Hin1II	CATG	1 cut(s)	350
Hin6I	GCGC	1 cut(s)	203
HinP1I	GCGC	1 cut(s)	203
HpaII	CCGG	1 cut(s)	41
HphI	GGTGA	2 cut(s)	130, 322
Hpy166II	GTNNAC	2 cut(s)	121, 313
Hpy188III	TCNNGA	4 cut(s)	155, 172, 347, 364
Hpy8I	GTNNAC	2 cut(s)	121, 313
Hpy99I	CGWCG	1 cut(s)	156
HpyAV	CCTTC	4 cut(s)	108, 119, 151, 311
HpyCH4III	ACNGT	2 cut(s)	118, 310
HpyCH4IV	ACGT	1 cut(s)	343
HpyF3I	CTNAG	4 cut(s)	198, 207, 390, 399
HpySE526I	ACGT	1 cut(s)	343
Hsp92I	GRCGYC	1 cut(s)	203
Hsp92II	CATG	1 cut(s)	350
HspAI	GCGC	1 cut(s)	203
KasI	GGCGCC	1 cut(s)	202
KpnI	GGTACC	1 cut(s)	57
Kzo9I	GATC	2 cut(s)	128, 320
LmnI	GCTCC	1 cut(s)	43
LpnPI	CCDG	5 cut(s)	54, 157, 246, 346, 349
Lsp1109I	GCAGC	4 cut(s)	83, 86, 275, 278
MaeI	CTAG	1 cut(s)	47
MaeII	ACGT	1 cut(s)	343
MaeIII	GTNAC	4 cut(s)	136, 193, 328, 385
MalI	GATC	2 cut(s)	130, 322
MboI	GATC	2 cut(s)	128, 320
MflI	RGATCY	2 cut(s)	128, 320
MlsI	TGGCCA	1 cut(s)	232
MluNI	TGGCCA	1 cut(s)	232
Mly113I	GGCGCC	1 cut(s)	203
MmeI	TCCRAC	1 cut(s)	223
MnlI	CCTC	5 cut(s)	58, 250, 301, 335, 385
Mox20I	TGGCCA	1 cut(s)	232
MscI	TGGCCA	1 cut(s)	232
MseI	TTAA	1 cut(s)	409
Msp20I	TGGCCA	1 cut(s)	232
MspI	CCGG	1 cut(s)	41
MvnI	CGCG	1 cut(s)	156
NarI	GGCGCC	1 cut(s)	203
NdeII	GATC	2 cut(s)	128, 320
NlaIII	CATG	1 cut(s)	350
NlaIV	GGNNCC	5 cut(s)	55, 204, 247, 322, 396
NmuCI	GTSAC	4 cut(s)	136, 193, 328, 385
NruI	TCGCGA	1 cut(s)	156
PagI	TCATGA	1 cut(s)	346
PkrI	GCNGC	4 cut(s)	73, 76, 265, 268
PluTI	GGCGCC	1 cut(s)	206
PspN4I	GGNNCC	5 cut(s)	55, 204, 247, 322, 396
PspPI	GGNCC	1 cut(s)	394
PsuI	RGATCY	2 cut(s)	128, 320
RruI	TCGCGA	1 cut(s)	156
RsaI	GTAC	1 cut(s)	55
RsaNI	GTAC	1 cut(s)	54
SaqAI	TTAA	1 cut(s)	409
SatI	GCNGC	4 cut(s)	72, 75, 264, 267
Sau3AI	GATC	2 cut(s)	128, 320
Sau96I	GGNCC	1 cut(s)	394
SetI	ASST	4 cut(s)	48, 143, 335, 346
SfoI	GGCGCC	1 cut(s)	204
SspDI	GGCGCC	1 cut(s)	202
SspMI	CTAG	1 cut(s)	47
TaaI	ACNGT	2 cut(s)	118, 310
TaiI	ACGT	1 cut(s)	346
TaqI	TCGA	1 cut(s)	144
Tru1I	TTAA	1 cut(s)	409
Tru9I	TTAA	1 cut(s)	409
TscAI	CASTG	1 cut(s)	394
TseFI	GTSAC	4 cut(s)	136, 193, 328, 385
TseI	GCWGC	4 cut(s)	71, 74, 263, 266
Tsp45I	GTSAC	4 cut(s)	136, 193, 328, 385
TspRI	CASTG	1 cut(s)	394
XspI	CTAG	1 cut(s)	47

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.