RchiOBHm_Chr2g0147101

Protein mrp homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
64772328 .. 64773047
720 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 168 bp
ATGTTTTCAAAGTTGAAGGCAGAAACCTTGATTACATTTATCTGGCAGCTATCTGCGTCTGGAGATAGTGGAGTACCTGAAGTGGTAGCTGATCCTCTAGGTGAAGTTTCGAGGACATTTCAGGAGCTTGGAATATGTGTTGTTGGCTTGAAATGCGTAGCTAGTTAG

Protein Analysis

55

Amino Acids

5.83

Weight (kDa)

4.66

Isoelectric Point (pI)

18.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 86
AcuI CTGAAG 1 cut(s) 99
AfaI GTAC 1 cut(s) 75
AgsI TTSAA 3 cut(s) 9, 16, 151
AluBI AGCT 4 cut(s) 49, 89, 127, 161
AluI AGCT 4 cut(s) 49, 89, 127, 161
AlwI GGATC 1 cut(s) 86
ApeKI GCWGC 1 cut(s) 46
AsuHPI GGTGA 1 cut(s) 113
BbvI GCAGC 1 cut(s) 58
BfaI CTAG 2 cut(s) 98, 162
BisI GCNGC 1 cut(s) 47
BlsI GCNGC 1 cut(s) 48
BpmI CTGGAG 1 cut(s) 81
BseXI GCAGC 1 cut(s) 58
Bsp143I GATC 1 cut(s) 91
BspPI GGATC 1 cut(s) 86
BssMI GATC 1 cut(s) 91
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 153
BstV1I GCAGC 1 cut(s) 58
CseI GACGC 1 cut(s) 45
Csp6I GTAC 1 cut(s) 74
CviJI RGCY 5 cut(s) 49, 89, 127, 147, 161
CviKI_1 RGCY 5 cut(s) 49, 89, 127, 147, 161
CviQI GTAC 1 cut(s) 74
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco57I CTGAAG 1 cut(s) 99
FaiI YATR 1 cut(s) 136
Fnu4HI GCNGC 1 cut(s) 47
Fsp4HI GCNGC 1 cut(s) 47
FspBI CTAG 2 cut(s) 98, 162
GluI GCNGC 1 cut(s) 47
GsuI CTGGAG 1 cut(s) 81
HgaI GACGC 1 cut(s) 45
HphI GGTGA 1 cut(s) 113
Hpy188III TCNNGA 2 cut(s) 60, 122
HpyAV CCTTC 1 cut(s) 10
HpyF10VI GCNNNNNNNGC 1 cut(s) 153
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 4 cut(s) 28, 45, 90, 107
Lsp1109I GCAGC 1 cut(s) 58
MaeI CTAG 2 cut(s) 98, 162
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MnlI CCTC 2 cut(s) 105, 105
MwoI GCNNNNNNNGC 1 cut(s) 153
NdeII GATC 1 cut(s) 91
PkrI GCNGC 1 cut(s) 48
RsaI GTAC 1 cut(s) 75
RsaNI GTAC 1 cut(s) 74
SatI GCNGC 1 cut(s) 47
Sau3AI GATC 1 cut(s) 91
SetI ASST 7 cut(s) 29, 51, 79, 91, 103, 129, 163
SgeI CNNG 9 cut(s) 40, 55, 72, 89, 110, 123, 134, 140, 160
SspMI CTAG 2 cut(s) 98, 162
TaqI TCGA 1 cut(s) 110
TseI GCWGC 1 cut(s) 46
XspI CTAG 2 cut(s) 98, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.