Rmu_sc0002882.1_g000018

Protein mrp homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002882.1
Physical Location & Seq
Forward (+)
50949 .. 51657
709 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002882.1_g000018.1.cds

Sequence Viewer

Length: 201 bp
atgttcttaggctcagaggttgtaaagcagtttggtatccctaatctatttgattttcccattagaccaactctatctttgtctggagatcgtggagtacctgaagtggtagctgatcctctaggtgaagtttctaagacatttcaggagcttggaatatgtgttgtgcaacaatgtgctaagattcaccaacaaggttaa

Protein Analysis

66

Amino Acids

7.17

Weight (kDa)

5.05

Isoelectric Point (pI)

27.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 110
AcuI CTGAAG 1 cut(s) 123
AfaI GTAC 1 cut(s) 99
AluBI AGCT 2 cut(s) 113, 151
AluI AGCT 2 cut(s) 113, 151
AlwI GGATC 1 cut(s) 110
AsuHPI GGTGA 2 cut(s) 137, 179
BciVI GTATCC 1 cut(s) 47
BfaI CTAG 1 cut(s) 122
BfuI GTATCC 1 cut(s) 47
BpmI CTGGAG 1 cut(s) 105
BseMII CTCAG 1 cut(s) 27
Bsp143I GATC 2 cut(s) 88, 115
BspCNI CTCAG 1 cut(s) 26
BspPI GGATC 1 cut(s) 110
BssMI GATC 2 cut(s) 88, 115
BstDEI CTNAG 4 cut(s) 7, 13, 135, 180
BstKTI GATC 2 cut(s) 91, 118
BstMBI GATC 2 cut(s) 88, 115
BsuI GTATCC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 98
CviJI RGCY 3 cut(s) 12, 113, 151
CviKI_1 RGCY 3 cut(s) 12, 113, 151
CviQI GTAC 1 cut(s) 98
DdeI CTNAG 4 cut(s) 7, 13, 135, 180
DpnI GATC 2 cut(s) 90, 117
DpnII GATC 2 cut(s) 88, 115
Eco57I CTGAAG 1 cut(s) 123
FaiI YATR 1 cut(s) 160
FspBI CTAG 1 cut(s) 122
GsuI CTGGAG 1 cut(s) 105
HinfI GANTC 1 cut(s) 184
HphI GGTGA 2 cut(s) 137, 179
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 84, 146
HpyCH4V TGCA 1 cut(s) 169
HpyF3I CTNAG 4 cut(s) 7, 13, 135, 180
Kzo9I GATC 2 cut(s) 88, 115
LmnI GCTCC 1 cut(s) 148
LpnPI CCDG 3 cut(s) 69, 114, 131
MaeI CTAG 1 cut(s) 122
MalI GATC 2 cut(s) 90, 117
MboI GATC 2 cut(s) 88, 115
MnlI CCTC 2 cut(s) 10, 129
MseI TTAA 1 cut(s) 199
NdeII GATC 2 cut(s) 88, 115
PfeI GAWTC 1 cut(s) 184
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
SaqAI TTAA 1 cut(s) 199
Sau3AI GATC 2 cut(s) 88, 115
SetI ASST 6 cut(s) 21, 103, 115, 127, 153, 199
SgeI CNNG 6 cut(s) 96, 104, 113, 134, 158, 164
SspMI CTAG 1 cut(s) 122
TfiI GAWTC 1 cut(s) 184
Tru1I TTAA 1 cut(s) 199
Tru9I TTAA 1 cut(s) 199
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.