Rmu_sc0030390.1_g000001

Protein mrp homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0030390.1
Physical Location & Seq
Forward (+)
1 .. 368
368 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0030390.1_g000001.1.cds

Sequence Viewer

Length: 168 bp
gcagaaaccttgattacatttatctggcagctatctgcgtctggagatagtggagtacctgaagtggtagctgatcctctaggtgaagtttcgaggacatttcaggagcttggaatatgtgttgtgcaacaatgtgctcagattcgccaacaaggtaagctatcttag

Protein Analysis

55

Amino Acids

5.9

Weight (kDa)

4.36

Isoelectric Point (pI)

31.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 68
AcuI CTGAAG 1 cut(s) 81
AfaI GTAC 1 cut(s) 57
AluBI AGCT 4 cut(s) 31, 71, 109, 160
AluI AGCT 4 cut(s) 31, 71, 109, 160
Alw21I GWGCWC 1 cut(s) 139
AlwI GGATC 1 cut(s) 68
ApeKI GCWGC 1 cut(s) 28
AsuHPI GGTGA 1 cut(s) 95
Bbv12I GWGCWC 1 cut(s) 139
BbvI GCAGC 1 cut(s) 40
BfaI CTAG 1 cut(s) 80
BisI GCNGC 1 cut(s) 29
BlsI GCNGC 1 cut(s) 30
BpmI CTGGAG 1 cut(s) 63
BseMII CTCAG 1 cut(s) 152
BseXI GCAGC 1 cut(s) 40
BsiHKAI GWGCWC 1 cut(s) 139
Bsp1286I GDGCHC 1 cut(s) 139
Bsp143I GATC 1 cut(s) 73
BspCNI CTCAG 1 cut(s) 151
BspPI GGATC 1 cut(s) 68
BssMI GATC 1 cut(s) 73
BstDEI CTNAG 2 cut(s) 138, 165
BstKTI GATC 1 cut(s) 76
BstMBI GATC 1 cut(s) 73
BstV1I GCAGC 1 cut(s) 40
CseI GACGC 1 cut(s) 27
Csp6I GTAC 1 cut(s) 56
CviJI RGCY 4 cut(s) 31, 71, 109, 160
CviKI_1 RGCY 4 cut(s) 31, 71, 109, 160
CviQI GTAC 1 cut(s) 56
DdeI CTNAG 2 cut(s) 138, 165
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
Eco57I CTGAAG 1 cut(s) 81
FaiI YATR 1 cut(s) 118
Fnu4HI GCNGC 1 cut(s) 29
Fsp4HI GCNGC 1 cut(s) 29
FspBI CTAG 1 cut(s) 80
GluI GCNGC 1 cut(s) 29
GsuI CTGGAG 1 cut(s) 63
HgaI GACGC 1 cut(s) 27
HinfI GANTC 1 cut(s) 142
HphI GGTGA 1 cut(s) 95
Hpy188I TCNGA 1 cut(s) 141
Hpy188III TCNNGA 2 cut(s) 42, 104
HpyCH4V TGCA 1 cut(s) 127
HpyF3I CTNAG 2 cut(s) 138, 165
Kzo9I GATC 1 cut(s) 73
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 4 cut(s) 10, 27, 72, 89
Lsp1109I GCAGC 1 cut(s) 40
MaeI CTAG 1 cut(s) 80
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MhlI GDGCHC 1 cut(s) 139
MnlI CCTC 2 cut(s) 87, 87
NdeII GATC 1 cut(s) 73
PfeI GAWTC 1 cut(s) 142
PkrI GCNGC 1 cut(s) 30
RsaI GTAC 1 cut(s) 57
RsaNI GTAC 1 cut(s) 56
SatI GCNGC 1 cut(s) 29
Sau3AI GATC 1 cut(s) 73
SduI GDGCHC 1 cut(s) 139
SetI ASST 8 cut(s) 11, 33, 61, 73, 85, 111, 157, 162
SgeI CNNG 9 cut(s) 22, 37, 54, 71, 92, 105, 116, 122, 164
SspMI CTAG 1 cut(s) 80
TaqI TCGA 1 cut(s) 92
TfiI GAWTC 1 cut(s) 142
TseI GCWGC 1 cut(s) 28
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.