Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr1D

Orthogroup ID

OG0003964

Physical Location & Seq

Genomic Coordinates Reverse (-)

23057220 .. 23057496

Gene Structure 277 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh1DG125700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 165 bp

ATGAGCCATTTTGATGCTGATGGGAAGCGTCATTACCCATTTGGTAAAGGCTTAGGCTCAGAGGTTGTAAAGCAGTTTGGTATCCCTAATCTATTTGATTTTCCCATTAGACCAACTGTAAGTCCTATGTTTTTTCAGTTCACTTATCATTCGAAATTGCTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006790 GO:0008150 GO:0008152 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009987 GO:0016043 GO:0016226 GO:0022607 GO:0031163 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044085 GO:0044237 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0048037 GO:0051186 GO:0051536 GO:0051540 GO:0071840

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF971 FeS_assembly_P ParA

Protein Analysis

54

Amino Acids

6.23

Weight (kDa)

9.3

Isoelectric Point (pI)

53.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003964)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0332011 RchiOBHm_Chr2g0090851 RchiOBHm_Chr2g0147101 RchiOBHm_Chr3g0496131
rosa_multiflora	Rmu_sc0002882.1_g000018 Rmu_sc0030390.1_g000001
rosa_samantha	Rh1DG125700 Rh2AG358500 Rh2AG463300 Rh2CG450100 Rh2DG320200 Rh3AG171400 Rh3AG326900 Rh3BG097800 Rh3BG144000 Rh3BG197000 Rh3CG145400 Rh3CG187900 Rh3DG145200 Rh4AG145300 Rh4AG256400 Rh4BG261800 Rh4DG132600 Rh5AG231200 Rh5AG444900 Rh5BG346900 Rh5CG263900 Rh5CG479600 Rh5DG360000 Rh6CG162300 Rh6DG153900 Rh7AG437000 Rh7BG440000
rosa_wichuraiana	Rw5G029020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AsuII	TTCGAA	1 cut(s)	152
BarI	GAAGNNNNNNTAC	2 cut(s)	17, 49
BccI	CCATC	1 cut(s)	14
BciVI	GTATCC	1 cut(s)	92
BfaI	CTAG	1 cut(s)	163
BfuI	GTATCC	1 cut(s)	92
BmsI	GCATC	1 cut(s)	4
Bpu10I	CCTNAGC	1 cut(s)	52
Bpu14I	TTCGAA	1 cut(s)	152
BseMII	CTCAG	1 cut(s)	72
Bsp119I	TTCGAA	1 cut(s)	152
BspCNI	CTCAG	1 cut(s)	71
BspT104I	TTCGAA	1 cut(s)	152
Bst4CI	ACNGT	1 cut(s)	118
BstBI	TTCGAA	1 cut(s)	152
BstDEI	CTNAG	2 cut(s)	52, 58
BsuI	GTATCC	1 cut(s)	92
CseI	GACGC	1 cut(s)	17
CviJI	RGCY	3 cut(s)	6, 51, 57
CviKI_1	RGCY	3 cut(s)	6, 51, 57
DdeI	CTNAG	2 cut(s)	52, 58
FaiI	YATR	1 cut(s)	128
FspBI	CTAG	1 cut(s)	163
HgaI	GACGC	1 cut(s)	17
Hpy166II	GTNNAC	1 cut(s)	141
Hpy188I	TCNGA	1 cut(s)	61
Hpy8I	GTNNAC	1 cut(s)	141
HpyCH4III	ACNGT	1 cut(s)	118
HpyF3I	CTNAG	2 cut(s)	52, 58
LweI	GCATC	1 cut(s)	4
MaeI	CTAG	1 cut(s)	163
MluCI	AATT	1 cut(s)	155
MnlI	CCTC	1 cut(s)	55
MslI	CAYNNNNRTG	1 cut(s)	12
NspV	TTCGAA	1 cut(s)	152
RseI	CAYNNNNRTG	1 cut(s)	12
SetI	ASST	1 cut(s)	66
SfaNI	GCATC	1 cut(s)	4
SfuI	TTCGAA	1 cut(s)	152
SmiMI	CAYNNNNRTG	1 cut(s)	12
Sse9I	AATT	1 cut(s)	155
SspMI	CTAG	1 cut(s)	163
TaaI	ACNGT	1 cut(s)	118
TaqI	TCGA	1 cut(s)	152
TasI	AATT	1 cut(s)	155
XspI	CTAG	1 cut(s)	163

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.