Rh4DG132600

Protein mrp homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
26290178 .. 26411425
121248 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG132600.1

Sequence Viewer

Length: 159 bp
ATGTTTTCAAAGTTGAAGCTATCTGCGTCTGGAGATAGTGGAGTACCTGAAGTGGTAGCTGATCCTCTAGGTGAAGTTTTGAGGACATTTCAGGAGCTTGGAATATGTGTTGTGCAACAATGTGCTAAGATTCGCCAACAAGTTTCTTCCAATGTTTAG

Protein Analysis

52

Amino Acids

5.56

Weight (kDa)

6.03

Isoelectric Point (pI)

29.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 56
AcuI CTGAAG 1 cut(s) 69
AfaI GTAC 1 cut(s) 45
AgsI TTSAA 2 cut(s) 9, 16
AluBI AGCT 3 cut(s) 19, 59, 97
AluI AGCT 3 cut(s) 19, 59, 97
AlwI GGATC 1 cut(s) 56
AsuHPI GGTGA 1 cut(s) 83
BfaI CTAG 1 cut(s) 68
BpmI CTGGAG 1 cut(s) 51
Bsp143I GATC 1 cut(s) 61
BspPI GGATC 1 cut(s) 56
BssMI GATC 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 126
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
CseI GACGC 1 cut(s) 15
Csp6I GTAC 1 cut(s) 44
CviJI RGCY 3 cut(s) 19, 59, 97
CviKI_1 RGCY 3 cut(s) 19, 59, 97
CviQI GTAC 1 cut(s) 44
DdeI CTNAG 1 cut(s) 126
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Eco57I CTGAAG 1 cut(s) 69
FaiI YATR 1 cut(s) 106
FspBI CTAG 1 cut(s) 68
GsuI CTGGAG 1 cut(s) 51
HgaI GACGC 1 cut(s) 15
HinfI GANTC 1 cut(s) 130
HphI GGTGA 1 cut(s) 83
Hpy188III TCNNGA 2 cut(s) 30, 92
HpyCH4V TGCA 1 cut(s) 115
HpyF3I CTNAG 1 cut(s) 126
Kzo9I GATC 1 cut(s) 61
LmnI GCTCC 1 cut(s) 94
LpnPI CCDG 3 cut(s) 15, 60, 77
MaeI CTAG 1 cut(s) 68
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 138
MnlI CCTC 2 cut(s) 75, 75
NdeII GATC 1 cut(s) 61
PfeI GAWTC 1 cut(s) 130
RsaI GTAC 1 cut(s) 45
RsaNI GTAC 1 cut(s) 44
Sau3AI GATC 1 cut(s) 61
SetI ASST 5 cut(s) 21, 49, 61, 73, 99
SgeI CNNG 6 cut(s) 42, 59, 80, 104, 110, 152
SspMI CTAG 1 cut(s) 68
TfiI GAWTC 1 cut(s) 130
XspI CTAG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.