RchiOBHm_Chr1g0317881

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
5399255 .. 5404524
5270 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 354 bp
ATGGACAAGTATGATGGTAGAGTTTGTATGAGTTCAGAGTCGATGAGTAGAATAGAGGCAATGTTTGAAGCTGAACTTGAGAGGTTGGGGCTAAACAGGAGTACTTCTACTTTGGAGAGAAGATTAACTGATCTTGATGAGCTTCCAAACAGTGTTCATCAAGTTTCTGAAGATTACATTTGGGAAAGCTTTATACTTTACAGGCCAATGTTTACATCAGAGGAAGTGGAGGTTCTCAGTCTAAACCAATTCTTGCTGGCTATTCATCATGCACACCCTCGGTCAGAAACCATGTTGCTTCTTCACCATCAAAGTTTTGATTTCTCTCTTGGCCGCCATAACATCAGCAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

13.72

Weight (kDa)

5.11

Isoelectric Point (pI)

67.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 334
AcoI YGGCCR 1 cut(s) 331
AcuI CTGAAG 1 cut(s) 189
AfaI GTAC 1 cut(s) 103
AgsI TTSAA 1 cut(s) 68
AluBI AGCT 3 cut(s) 71, 142, 189
AluI AGCT 3 cut(s) 71, 142, 189
AoxI GGCC 2 cut(s) 203, 331
AsuHPI GGTGA 1 cut(s) 296
BccI CCATC 2 cut(s) 8, 315
BfaI CTAG 1 cut(s) 352
BisI GCNGC 1 cut(s) 334
BlsI GCNGC 1 cut(s) 335
BmcAI AGTACT 1 cut(s) 103
BpuEI CTTGAG 1 cut(s) 98
BsaJI CCNNGG 1 cut(s) 278
Bse3DI GCAATG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 278
BseMI GCAATG 1 cut(s) 66
BseMII CTCAG 1 cut(s) 250
BshFI GGCC 2 cut(s) 205, 333
BsnI GGCC 2 cut(s) 205, 333
Bsp143I GATC 1 cut(s) 130
BspACI CCGC 1 cut(s) 334
BspANI GGCC 2 cut(s) 205, 333
BspCNI CTCAG 1 cut(s) 249
BsrDI GCAATG 1 cut(s) 66
BssECI CCNNGG 1 cut(s) 278
BssMI GATC 1 cut(s) 130
Bst4CI ACNGT 1 cut(s) 152
BstC8I GCNNGC 1 cut(s) 258
BstDEI CTNAG 1 cut(s) 236
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BsuRI GGCC 2 cut(s) 205, 333
BtsIMutI CAGTG 1 cut(s) 157
Cac8I GCNNGC 1 cut(s) 258
Csp6I GTAC 1 cut(s) 102
CviAII CATG 2 cut(s) 269, 292
CviJI RGCY 7 cut(s) 71, 91, 142, 189, 205, 260, 333
CviKI_1 RGCY 7 cut(s) 71, 91, 142, 189, 205, 260, 333
CviQI GTAC 1 cut(s) 102
DdeI CTNAG 1 cut(s) 236
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
EaeI YGGCCR 1 cut(s) 331
Eco57I CTGAAG 1 cut(s) 189
FaeI CATG 2 cut(s) 272, 295
FaiI YATR 6 cut(s) 12, 29, 194, 270, 293, 339
FalI AAGNNNNNCTT 2 cut(s) 60, 92
FatI CATG 2 cut(s) 268, 291
Fnu4HI GCNGC 1 cut(s) 334
Fsp4HI GCNGC 1 cut(s) 334
FspBI CTAG 1 cut(s) 352
GluI GCNGC 1 cut(s) 334
HaeIII GGCC 2 cut(s) 205, 333
Hin1II CATG 2 cut(s) 272, 295
HindIII AAGCTT 1 cut(s) 187
HinfI GANTC 1 cut(s) 38
HphI GGTGA 1 cut(s) 296
Hpy166II GTNNAC 1 cut(s) 213
Hpy188I TCNGA 4 cut(s) 37, 169, 220, 286
Hpy188III TCNNGA 1 cut(s) 134
Hpy8I GTNNAC 1 cut(s) 213
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 272
HpyF3I CTNAG 1 cut(s) 236
Hsp92II CATG 2 cut(s) 272, 295
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 3 cut(s) 82, 187, 242
MaeI CTAG 1 cut(s) 352
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 3 cut(s) 132, 182, 293
MluCI AATT 1 cut(s) 248
MlyI GAGTC 1 cut(s) 47
MnlI CCTC 5 cut(s) 49, 75, 214, 223, 288
MseI TTAA 1 cut(s) 125
NdeII GATC 1 cut(s) 130
NlaIII CATG 2 cut(s) 272, 295
PkrI GCNGC 1 cut(s) 335
PleI GAGTC 1 cut(s) 46
PpsI GAGTC 1 cut(s) 46
RsaI GTAC 1 cut(s) 103
RsaNI GTAC 1 cut(s) 102
SaqAI TTAA 1 cut(s) 125
SatI GCNGC 1 cut(s) 334
Sau3AI GATC 1 cut(s) 130
ScaI AGTACT 1 cut(s) 103
SchI GAGTC 1 cut(s) 47
SetI ASST 5 cut(s) 73, 86, 144, 191, 234
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 1 cut(s) 248
SsiI CCGC 1 cut(s) 334
SspMI CTAG 1 cut(s) 352
TaaI ACNGT 1 cut(s) 152
TaqI TCGA 1 cut(s) 41
TaqII GACCGA 1 cut(s) 270
TasI AATT 1 cut(s) 248
TatI WGTACW 1 cut(s) 101
TauI GCSGC 1 cut(s) 336
Tru1I TTAA 1 cut(s) 125
Tru9I TTAA 1 cut(s) 125
TscAI CASTG 1 cut(s) 157
TspDTI ATGAA 2 cut(s) 146, 254
TspRI CASTG 1 cut(s) 157
XspI CTAG 1 cut(s) 352
ZrmI AGTACT 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.