Rroxscaffold_4G00327040

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
59441217 .. 59445041
3825 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00327040.1

Sequence Viewer

Length: 177 bp
ATGGACAAGTATGATGGTAGAGTTTGTATGAGTTCAGAGTTGATGAGTAAAATGGAGGCAATGTTTGAAGCTGAACTTGAGAGGTTTGGGCTAAACAGAAGTATTTCTACTTTGGAGAGCAGATTAACTGATCTTGATGAGGTTCCAAACAGTGTTCATCAAGCCACATGTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.59

Weight (kDa)

4.57

Isoelectric Point (pI)

63.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 167
AgsI TTSAA 1 cut(s) 68
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Asp700I GAANNNNTTC 1 cut(s) 103
BarI GAAGNNNNNNTAC 2 cut(s) 91, 123
BccI CCATC 1 cut(s) 8
BmiI GGNNCC 1 cut(s) 144
BpuEI CTTGAG 1 cut(s) 98
BsaXI ACNNNNNCTCC 2 cut(s) 47, 77
Bse3DI GCAATG 1 cut(s) 66
BseMI GCAATG 1 cut(s) 66
Bsp143I GATC 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 144
BsrDI GCAATG 1 cut(s) 66
BssMI GATC 1 cut(s) 130
Bst4CI ACNGT 1 cut(s) 152
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BstNSI RCATGY 1 cut(s) 171
BtsIMutI CAGTG 1 cut(s) 157
CviAII CATG 1 cut(s) 168
CviJI RGCY 3 cut(s) 71, 91, 164
CviKI_1 RGCY 3 cut(s) 71, 91, 164
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
FaeI CATG 1 cut(s) 171
FaiI YATR 4 cut(s) 12, 29, 169, 175
FalI AAGNNNNNCTT 2 cut(s) 60, 92
FatI CATG 1 cut(s) 167
FspEI CC 8 cut(s) 38, 41, 67, 72, 73, 98, 125, 159
Hin1II CATG 1 cut(s) 171
Hpy188I TCNGA 1 cut(s) 37
Hpy188III TCNNGA 1 cut(s) 134
HpyCH4III ACNGT 1 cut(s) 152
Hsp92II CATG 1 cut(s) 171
Kzo9I GATC 1 cut(s) 130
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MnlI CCTC 3 cut(s) 49, 75, 133
MroXI GAANNNNTTC 1 cut(s) 103
MseI TTAA 1 cut(s) 125
NdeII GATC 1 cut(s) 130
NlaIII CATG 1 cut(s) 171
NlaIV GGNNCC 1 cut(s) 144
NspI RCATGY 1 cut(s) 171
PciI ACATGT 1 cut(s) 167
PdmI GAANNNNTTC 1 cut(s) 103
PscI ACATGT 1 cut(s) 167
PspN4I GGNNCC 1 cut(s) 144
SaqAI TTAA 1 cut(s) 125
Sau3AI GATC 1 cut(s) 130
SetI ASST 3 cut(s) 73, 86, 144
SgeI CNNG 4 cut(s) 19, 89, 146, 173
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
TaaI ACNGT 1 cut(s) 152
Tru1I TTAA 1 cut(s) 125
Tru9I TTAA 1 cut(s) 125
TscAI CASTG 1 cut(s) 157
TspDTI ATGAA 2 cut(s) 146, 162
TspRI CASTG 1 cut(s) 157
XceI RCATGY 1 cut(s) 171
XmnI GAANNNNTTC 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.