Rroxscaffold_3G00235560

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
22580897 .. 22582431
1535 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00235560.1

Sequence Viewer

Length: 225 bp
ATGGATAAGTATGATGGCAGAGTTCGTATCAGTAGAAAGCTGAGGAGTTCAGAGTCGATGAGTAAAATAGAGGCCAAGCTTGAAGCCGAACTTGAGAGGTTGGGGCTAAACACGAATACTTCTACTTTGGAGAGAAGATTTACTGATCTTGATGAGGTTCTTGAAGAGAAGAGGAAGGCTCTGGCTACACTGAGAAGAAAAGAGTTGACTTGGACAAAGAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.73

Weight (kDa)

9.69

Isoelectric Point (pI)

57.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 83, 164
AluBI AGCT 3 cut(s) 40, 79, 222
AluI AGCT 3 cut(s) 40, 79, 222
AoxI GGCC 1 cut(s) 72
BbvCI CCTCAGC 1 cut(s) 41
BccI CCATC 1 cut(s) 8
BplI GAGNNNNNCTC 2 cut(s) 163, 195
Bpu10I CCTNAGC 1 cut(s) 41
BpuEI CTTGAG 1 cut(s) 113
BseMII CTCAG 2 cut(s) 32, 182
BseRI GAGGAG 1 cut(s) 58
BshFI GGCC 1 cut(s) 74
BsnI GGCC 1 cut(s) 74
Bsp143I GATC 1 cut(s) 145
BspANI GGCC 1 cut(s) 74
BspCNI CTCAG 2 cut(s) 33, 183
BssMI GATC 1 cut(s) 145
Bst6I CTCTTC 2 cut(s) 159, 164
BstDEI CTNAG 2 cut(s) 41, 191
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
BsuRI GGCC 1 cut(s) 74
BtsIMutI CAGTG 1 cut(s) 188
CviJI RGCY 8 cut(s) 40, 74, 79, 86, 106, 179, 185, 222
CviKI_1 RGCY 8 cut(s) 40, 74, 79, 86, 106, 179, 185, 222
DdeI CTNAG 2 cut(s) 41, 191
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
Eam1104I CTCTTC 2 cut(s) 159, 164
EarI CTCTTC 2 cut(s) 159, 164
FaiI YATR 1 cut(s) 12
FalI AAGNNNNNCTT 2 cut(s) 75, 107
HaeIII GGCC 1 cut(s) 74
HincII GTYRAC 1 cut(s) 207
HindII GTYRAC 1 cut(s) 207
HindIII AAGCTT 1 cut(s) 77
HinfI GANTC 1 cut(s) 53
Hpy166II GTNNAC 1 cut(s) 207
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 2 cut(s) 149, 161
Hpy8I GTNNAC 1 cut(s) 207
HpyAV CCTTC 1 cut(s) 169
HpyF3I CTNAG 2 cut(s) 41, 191
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 1 cut(s) 167
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 4 cut(s) 147, 176, 181, 207
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 5 cut(s) 36, 64, 90, 148, 165
NdeII GATC 1 cut(s) 145
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
Sau3AI GATC 1 cut(s) 145
SchI GAGTC 1 cut(s) 62
SetI ASST 5 cut(s) 42, 81, 101, 159, 224
SgeI CNNG 7 cut(s) 88, 92, 104, 124, 161, 173, 194
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
TaqI TCGA 1 cut(s) 56
TscAI CASTG 1 cut(s) 195
TspRI CASTG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.