Rh5DG086000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
7569940 .. 7570361
422 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG086000.1

Sequence Viewer

Length: 336 bp
ATGCACACCTTCAGTCAGAAACCATGTTGCTTCTTCACCATCAAAGTTTTGATTTCTCTCTCAGTTTTGGCAGCCATAACATCAGCAACTAGAATTTACCCGGTGGCTCCAACTGATCACAGAACACAAGGTCTAGGAGCTTTAGAGATGAGTGCACCAGCTGTGAATAACAGACTGCTGCTGTTAGATTTGCAGCACCAGGTCAAGGTGGAAGTGGCTTCTCAAGATCAAGCTCATGTTCTATCAAGGCGTCCTAAAATCCCACCTTCTGGTCCAAGCCACAGGACCAACAAGACACCTAATTCCTCAAGACATTTGCTACTAGCTAGTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.12

Weight (kDa)

10.29

Isoelectric Point (pI)

49.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 269
AcsI RAATTY 1 cut(s) 93
AcyI GRCGYC 1 cut(s) 250
AfiI CCNNNNNNNGG 2 cut(s) 205, 269
AjnI CCWGG 1 cut(s) 198
AluBI AGCT 4 cut(s) 140, 161, 233, 326
AluI AGCT 4 cut(s) 140, 161, 233, 326
Alw21I GWGCWC 1 cut(s) 157
Alw44I GTGCAC 1 cut(s) 153
ApaLI GTGCAC 1 cut(s) 153
ApeKI GCWGC 3 cut(s) 71, 178, 193
ApoI RAATTY 1 cut(s) 93
AspS9I GGNCC 2 cut(s) 272, 285
AsuC2I CCSGG 1 cut(s) 101
AsuHPI GGTGA 1 cut(s) 28
AvaII GGWCC 2 cut(s) 272, 285
BaeGI GKGCMC 1 cut(s) 157
Bbv12I GWGCWC 1 cut(s) 157
BbvI GCAGC 3 cut(s) 83, 165, 205
BccI CCATC 1 cut(s) 47
BciT130I CCWGG 1 cut(s) 200
BclI TGATCA 1 cut(s) 115
BcnI CCSGG 1 cut(s) 101
BfaI CTAG 4 cut(s) 90, 134, 323, 327
BisI GCNGC 3 cut(s) 72, 179, 194
BlsI GCNGC 3 cut(s) 73, 180, 195
Bme1390I CCNGG 2 cut(s) 101, 200
Bme18I GGWCC 2 cut(s) 272, 285
BmgT120I GGNCC 2 cut(s) 272, 285
BmiI GGNNCC 1 cut(s) 108
BmrFI CCNGG 2 cut(s) 101, 200
BpuEI CTTGAG 2 cut(s) 207, 292
BpuMI CCSGG 1 cut(s) 101
BsaHI GRCGYC 1 cut(s) 250
Bsc4I CCNNNNNNNGG 2 cut(s) 205, 269
BseBI CCWGG 1 cut(s) 200
BseLI CCNNNNNNNGG 2 cut(s) 205, 269
BseMII CTCAG 1 cut(s) 75
BseSI GKGCMC 1 cut(s) 157
BseXI GCAGC 3 cut(s) 83, 165, 205
BsiHKAI GWGCWC 1 cut(s) 157
BsiSI CCGG 1 cut(s) 101
BslI CCNNNNNNNGG 2 cut(s) 205, 269
Bsp1286I GDGCHC 1 cut(s) 157
Bsp143I GATC 2 cut(s) 115, 226
BspCNI CTCAG 1 cut(s) 74
BspHI TCATGA 1 cut(s) 332
BspLI GGNNCC 1 cut(s) 108
BssMI GATC 2 cut(s) 115, 226
BssNI GRCGYC 1 cut(s) 250
Bst2UI CCWGG 1 cut(s) 200
BstACI GRCGYC 1 cut(s) 250
BstDEI CTNAG 1 cut(s) 61
BstKTI GATC 2 cut(s) 118, 229
BstMBI GATC 2 cut(s) 115, 226
BstNI CCWGG 1 cut(s) 200
BstSCI CCNGG 2 cut(s) 99, 198
BstSLI GKGCMC 1 cut(s) 157
BstV1I GCAGC 3 cut(s) 83, 165, 205
CciI TCATGA 1 cut(s) 332
Cfr13I GGNCC 2 cut(s) 272, 285
CseI GACGC 1 cut(s) 239
CsiI ACCWGGT 1 cut(s) 198
CviAII CATG 3 cut(s) 24, 236, 333
CviJI RGCY 8 cut(s) 74, 107, 140, 161, 218, 233, 279, 326
CviKI_1 RGCY 8 cut(s) 74, 107, 140, 161, 218, 233, 279, 326
DdeI CTNAG 1 cut(s) 61
DpnI GATC 2 cut(s) 117, 228
DpnII GATC 2 cut(s) 115, 226
Eco47I GGWCC 2 cut(s) 272, 285
EcoRII CCWGG 1 cut(s) 198
FaeI CATG 3 cut(s) 27, 239, 336
FaiI YATR 4 cut(s) 25, 77, 237, 334
FatI CATG 3 cut(s) 23, 235, 332
FbaI TGATCA 1 cut(s) 115
Fnu4HI GCNGC 3 cut(s) 72, 179, 194
Fsp4HI GCNGC 3 cut(s) 72, 179, 194
FspBI CTAG 4 cut(s) 90, 134, 323, 327
GluI GCNGC 3 cut(s) 72, 179, 194
HapII CCGG 1 cut(s) 101
HgaI GACGC 1 cut(s) 239
Hin1I GRCGYC 1 cut(s) 250
Hin1II CATG 3 cut(s) 27, 239, 336
HpaII CCGG 1 cut(s) 101
HphI GGTGA 1 cut(s) 28
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 3 cut(s) 224, 309, 333
Hpy8I GTNNAC 1 cut(s) 155
HpyAV CCTTC 2 cut(s) 19, 276
HpyCH4V TGCA 3 cut(s) 4, 155, 193
HpyF3I CTNAG 1 cut(s) 61
Hsp92I GRCGYC 1 cut(s) 250
Hsp92II CATG 3 cut(s) 27, 239, 336
Ksp22I TGATCA 1 cut(s) 115
Kzo9I GATC 2 cut(s) 115, 226
LmnI GCTCC 2 cut(s) 112, 137
LpnPI CCDG 6 cut(s) 114, 171, 185, 212, 255, 268
Lsp1109I GCAGC 3 cut(s) 83, 165, 205
MabI ACCWGGT 1 cut(s) 198
MaeI CTAG 4 cut(s) 90, 134, 323, 327
MalI GATC 2 cut(s) 117, 228
MboI GATC 2 cut(s) 115, 226
MboII GAAGA 1 cut(s) 25
MhlI GDGCHC 1 cut(s) 157
MluCI AATT 2 cut(s) 93, 301
MmeI TCCRAC 1 cut(s) 134
MnlI CCTC 1 cut(s) 316
MspA1I CMGCKG 1 cut(s) 161
MspI CCGG 1 cut(s) 101
MspR9I CCNGG 2 cut(s) 101, 200
MvaI CCWGG 1 cut(s) 200
NciI CCSGG 1 cut(s) 101
NdeII GATC 2 cut(s) 115, 226
NlaIII CATG 3 cut(s) 27, 239, 336
NlaIV GGNNCC 1 cut(s) 108
PagI TCATGA 1 cut(s) 332
PflMI CCANNNNNTGG 1 cut(s) 269
PkrI GCNGC 3 cut(s) 73, 180, 195
Psp6I CCWGG 1 cut(s) 198
PspGI CCWGG 1 cut(s) 198
PspN4I GGNNCC 1 cut(s) 108
PspPI GGNCC 2 cut(s) 272, 285
PvuII CAGCTG 1 cut(s) 161
SatI GCNGC 3 cut(s) 72, 179, 194
Sau3AI GATC 2 cut(s) 115, 226
Sau96I GGNCC 2 cut(s) 272, 285
ScrFI CCNGG 2 cut(s) 101, 200
SduI GDGCHC 1 cut(s) 157
SexAI ACCWGGT 1 cut(s) 198
SinI GGWCC 2 cut(s) 272, 285
SmlI CTYRAG 2 cut(s) 222, 307
SmoI CTYRAG 2 cut(s) 222, 307
Sse9I AATT 2 cut(s) 93, 301
SspMI CTAG 4 cut(s) 90, 134, 323, 327
StyD4I CCNGG 2 cut(s) 99, 198
TasI AATT 2 cut(s) 93, 301
TseI GCWGC 3 cut(s) 71, 178, 193
TspDTI ATGAA 1 cut(s) 321
Van91I CCANNNNNTGG 1 cut(s) 269
VneI GTGCAC 1 cut(s) 153
VpaK11BI GGWCC 2 cut(s) 272, 285
XapI RAATTY 1 cut(s) 93
XspI CTAG 4 cut(s) 90, 134, 323, 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.