Rh1BG179300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
28645421 .. 28645822
402 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG179300.1

Sequence Viewer

Length: 402 bp
ATGCAGGAACAAACCGCTCACTCATTGTCTCAAATTCTGGGTTGCTATCTGAACATGGATAAATTGGGTCCATCGCTGAAAAAGTCCATTGGGCCTCTGCTGATCACTGATGGTGCTCCATTTTCTATTCCTGAACCATTTGATGGGGCTTCTCTGCTGACAGACATTCAGATCCTACAGCGCACCTTTGGGATTTTCAATGACGCTCTTGGAGTGATCAATAGCCAAGATGTGGTGGTGGAAAAGGTTGGTGAGATGAAGCTTTTGGTTCAGCTGAAAATAGGTGGGCTCTGGACTAAAGGTGTGATTGTCCATCCCTGTGTGGAAGGCTCAGCTCTTGATGAGATAAAGAAACTCGGCAGTGATTATGGTATCACTGTCCAAGTGAGTGTCACCAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

133

Amino Acids

14.27

Weight (kDa)

4.99

Isoelectric Point (pI)

19.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 143, 232
AccBSI CCGCTC 1 cut(s) 17
AciI CCGC 1 cut(s) 15
AclWI GGATC 1 cut(s) 166
AcsI RAATTY 1 cut(s) 33
AfiI CCNNNNNNNGG 2 cut(s) 143, 232
AgsI TTSAA 1 cut(s) 199
AluBI AGCT 3 cut(s) 262, 274, 335
AluI AGCT 3 cut(s) 262, 274, 335
Alw21I GWGCWC 1 cut(s) 118
Alw26I GTCTC 1 cut(s) 33
AlwI GGATC 1 cut(s) 166
AoxI GGCC 1 cut(s) 92
ApoI RAATTY 1 cut(s) 33
AspLEI GCGC 1 cut(s) 183
AspS9I GGNCC 2 cut(s) 68, 92
AsuHPI GGTGA 2 cut(s) 263, 385
AvaII GGWCC 1 cut(s) 68
BanII GRGCYC 1 cut(s) 291
Bbv12I GWGCWC 1 cut(s) 118
BccI CCATC 4 cut(s) 79, 104, 137, 321
BclI TGATCA 2 cut(s) 102, 216
BcoDI GTCTC 1 cut(s) 33
BfaI CTAG 1 cut(s) 400
BfmI CTRYAG 1 cut(s) 176
BlpI GCTNAGC 1 cut(s) 331
Bme18I GGWCC 1 cut(s) 68
BmgT120I GGNCC 2 cut(s) 68, 92
BmiI GGNNCC 1 cut(s) 69
Bpu1102I GCTNAGC 1 cut(s) 331
Bsc4I CCNNNNNNNGG 2 cut(s) 143, 232
BseGI GGATG 1 cut(s) 313
BseLI CCNNNNNNNGG 2 cut(s) 143, 232
BseMII CTCAG 1 cut(s) 345
BshFI GGCC 1 cut(s) 94
BsiHKAI GWGCWC 1 cut(s) 118
BslI CCNNNNNNNGG 2 cut(s) 143, 232
BsmAI GTCTC 1 cut(s) 33
BsnI GGCC 1 cut(s) 94
Bsp1286I GDGCHC 2 cut(s) 118, 291
Bsp143I GATC 3 cut(s) 102, 171, 216
Bsp1720I GCTNAGC 1 cut(s) 331
BspACI CCGC 1 cut(s) 15
BspANI GGCC 1 cut(s) 94
BspCNI CTCAG 1 cut(s) 344
BspLI GGNNCC 1 cut(s) 69
BspPI GGATC 1 cut(s) 166
BsrBI CCGCTC 1 cut(s) 17
BssMI GATC 3 cut(s) 102, 171, 216
Bst4CI ACNGT 1 cut(s) 379
BstDEI CTNAG 1 cut(s) 331
BstF5I GGATG 1 cut(s) 313
BstHHI GCGC 1 cut(s) 183
BstKTI GATC 3 cut(s) 105, 174, 219
BstMAI GTCTC 1 cut(s) 33
BstMBI GATC 3 cut(s) 102, 171, 216
BstSFI CTRYAG 1 cut(s) 176
BstX2I RGATCY 1 cut(s) 171
BstYI RGATCY 1 cut(s) 171
BsuRI GGCC 1 cut(s) 94
BtgZI GCGATG 1 cut(s) 57
BtsCI GGATG 1 cut(s) 313
BtsI GCAGTG 1 cut(s) 367
BtsIMutI CAGTG 3 cut(s) 105, 367, 375
CfoI GCGC 1 cut(s) 183
Cfr13I GGNCC 2 cut(s) 68, 92
CseI GACGC 1 cut(s) 212
CviAII CATG 1 cut(s) 55
CviJI RGCY 8 cut(s) 94, 149, 225, 262, 274, 289, 330, 335
CviKI_1 RGCY 8 cut(s) 94, 149, 225, 262, 274, 289, 330, 335
DdeI CTNAG 1 cut(s) 331
DpnI GATC 3 cut(s) 104, 173, 218
DpnII GATC 3 cut(s) 102, 171, 216
Eco24I GRGCYC 1 cut(s) 291
Eco47I GGWCC 1 cut(s) 68
EcoT38I GRGCYC 1 cut(s) 291
FaeI CATG 1 cut(s) 58
FaiI YATR 2 cut(s) 56, 369
FatI CATG 1 cut(s) 54
FbaI TGATCA 2 cut(s) 102, 216
FokI GGATG 1 cut(s) 300
FriOI GRGCYC 1 cut(s) 291
FspBI CTAG 1 cut(s) 400
GlaI GCGC 1 cut(s) 182
HaeIII GGCC 1 cut(s) 94
HgaI GACGC 1 cut(s) 212
HhaI GCGC 1 cut(s) 183
Hin1II CATG 1 cut(s) 58
Hin6I GCGC 1 cut(s) 181
HinP1I GCGC 1 cut(s) 181
HindIII AAGCTT 1 cut(s) 260
HphI GGTGA 2 cut(s) 263, 385
Hpy188I TCNGA 2 cut(s) 51, 171
Hpy188III TCNNGA 3 cut(s) 131, 292, 338
HpyAV CCTTC 1 cut(s) 320
HpyCH4III ACNGT 1 cut(s) 379
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 331
Hsp92II CATG 1 cut(s) 58
HspAI GCGC 1 cut(s) 181
Ksp22I TGATCA 2 cut(s) 102, 216
Kzo9I GATC 3 cut(s) 102, 171, 216
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 4 cut(s) 23, 144, 277, 331
MaeI CTAG 1 cut(s) 400
MaeIII GTNAC 1 cut(s) 391
MalI GATC 3 cut(s) 104, 173, 218
MbiI CCGCTC 1 cut(s) 17
MboI GATC 3 cut(s) 102, 171, 216
MflI RGATCY 1 cut(s) 171
MhlI GDGCHC 2 cut(s) 118, 291
MluCI AATT 2 cut(s) 33, 62
MnlI CCTC 1 cut(s) 105
MslI CAYNNNNRTG 1 cut(s) 318
MspA1I CMGCKG 1 cut(s) 274
NdeII GATC 3 cut(s) 102, 171, 216
NlaIII CATG 1 cut(s) 58
NlaIV GGNNCC 1 cut(s) 69
NmeAIII GCCGAG 1 cut(s) 336
NmuCI GTSAC 1 cut(s) 391
PflMI CCANNNNNTGG 2 cut(s) 143, 232
PspN4I GGNNCC 1 cut(s) 69
PspPI GGNCC 2 cut(s) 68, 92
PsuI RGATCY 1 cut(s) 171
PvuII CAGCTG 1 cut(s) 274
RseI CAYNNNNRTG 1 cut(s) 318
Sau3AI GATC 3 cut(s) 102, 171, 216
Sau96I GGNCC 2 cut(s) 68, 92
SduI GDGCHC 2 cut(s) 118, 291
SetI ASST 7 cut(s) 188, 249, 264, 276, 286, 304, 337
SfcI CTRYAG 1 cut(s) 176
SinI GGWCC 1 cut(s) 68
SmiMI CAYNNNNRTG 1 cut(s) 318
Sse9I AATT 2 cut(s) 33, 62
SsiI CCGC 1 cut(s) 15
SspMI CTAG 1 cut(s) 400
TaaI ACNGT 1 cut(s) 379
TasI AATT 2 cut(s) 33, 62
TscAI CASTG 3 cut(s) 112, 367, 382
TseFI GTSAC 1 cut(s) 391
Tsp45I GTSAC 1 cut(s) 391
TspDTI ATGAA 1 cut(s) 272
TspRI CASTG 3 cut(s) 112, 367, 382
Van91I CCANNNNNTGG 2 cut(s) 143, 232
VpaK11BI GGWCC 1 cut(s) 68
XapI RAATTY 1 cut(s) 33
XspI CTAG 1 cut(s) 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.