Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004705.1

Orthogroup ID

OG0005526

Physical Location & Seq

Genomic Coordinates Reverse (-)

176207 .. 178117

Gene Structure 1911 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004705.1_g000039.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 327 bp

atggacaagtatgatggtagagattcgtacgagcagaaagctgaggagagttcagagttgatgaataaaataggggcagagcttgaacttgaacttgagaggttggggctaaacatgaatacttctactttggagggaagattaactgatcttgatgaggtccggacttggatcaacggtgtagaagccaacgagtatgttggtgtcgaggctcgatttggacctaccctggaatcaaaggagaagcatgccaataatactagagtggttctggcagacccccctgactgttgtaccaaacccaagaataaggtatacttgttatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000323 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005764 GO:0005765 GO:0005773 GO:0005774 GO:0005783 GO:0005789 GO:0005798 GO:0012505 GO:0016020 GO:0016021 GO:0030176 GO:0030660 GO:0031090 GO:0031224 GO:0031227 GO:0031410 GO:0031982 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044433 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0071458 GO:0071556 GO:0097708 GO:0098552 GO:0098553 GO:0098554 GO:0098562 GO:0098588 GO:0098805 GO:0098827 GO:0098852

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PA Peptidase_A22B

Protein Analysis

108

Amino Acids

12.24

Weight (kDa)

4.67

Isoelectric Point (pI)

23.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005526)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g07280
pyrus_communis	pycom05g27410
rosa_chinensis	RchiOBHm_Chr1g0317771 RchiOBHm_Chr1g0317881 RchiOBHm_Chr2g0127981
rosa_laevigata	RLG00000028639 RLG00000028642 RLG00000028648 RLG00000028650 RLG00000028656 RLG00000028967 RLG00000030392 RLG00000030584 RLG00000031858
rosa_multiflora	Rmu_sc0001701.1_g000005 Rmu_sc0004705.1_g000039
rosa_roxburghii	Rroxscaffold_3G00235560 Rroxscaffold_4G00316520 Rroxscaffold_4G00327040
rosa_rugosa	Rorug01G0017500 Rorug05G0579300
rosa_samantha	Rh1BG179300 Rh1DG042700 Rh1DG043600 Rh1DG209400 Rh4DG110000 Rh5DG086000 Rh6CG034000
rosa_wichuraiana	Rw6G029660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	315
AccIII	TCCGGA	1 cut(s)	162
AclWI	GGATC	1 cut(s)	179
AfaI	GTAC	2 cut(s)	29, 295
AgsI	TTSAA	2 cut(s)	86, 92
AjnI	CCWGG	1 cut(s)	228
AluBI	AGCT	2 cut(s)	41, 82
AluI	AGCT	2 cut(s)	41, 82
AlwI	GGATC	1 cut(s)	179
Aor13HI	TCCGGA	1 cut(s)	162
AspS9I	GGNCC	2 cut(s)	160, 221
AvaII	GGWCC	2 cut(s)	160, 221
BaeI	ACNNNNGTAYC	2 cut(s)	277, 310
BbvCI	CCTCAGC	1 cut(s)	42
BccI	CCATC	1 cut(s)	8
BciT130I	CCWGG	1 cut(s)	230
BfaI	CTAG	1 cut(s)	261
Bme1390I	CCNGG	1 cut(s)	230
Bme18I	GGWCC	2 cut(s)	160, 221
BmgT120I	GGNCC	2 cut(s)	160, 221
BmrFI	CCNGG	1 cut(s)	230
Bpu10I	CCTNAGC	1 cut(s)	42
BpuEI	CTTGAG	1 cut(s)	116
BsaJI	CCNNGG	1 cut(s)	228
BsaWI	WCCGGW	1 cut(s)	162
BseAI	TCCGGA	1 cut(s)	162
BseBI	CCWGG	1 cut(s)	230
BseDI	CCNNGG	1 cut(s)	228
BseMII	CTCAG	1 cut(s)	33
BseRI	GAGGAG	1 cut(s)	59
BsiSI	CCGG	1 cut(s)	163
BsiWI	CGTACG	1 cut(s)	27
Bsp13I	TCCGGA	1 cut(s)	162
Bsp143I	GATC	2 cut(s)	148, 171
BspCNI	CTCAG	1 cut(s)	34
BspEI	TCCGGA	1 cut(s)	162
BspPI	GGATC	1 cut(s)	179
BssECI	CCNNGG	1 cut(s)	228
BssMI	GATC	2 cut(s)	148, 171
BssNAI	GTATAC	1 cut(s)	316
Bst1107I	GTATAC	1 cut(s)	316
Bst2UI	CCWGG	1 cut(s)	230
Bst4CI	ACNGT	2 cut(s)	179, 290
BstC8I	GCNNGC	1 cut(s)	249
BstDEI	CTNAG	1 cut(s)	42
BstKTI	GATC	2 cut(s)	151, 174
BstMBI	GATC	2 cut(s)	148, 171
BstNI	CCWGG	1 cut(s)	230
BstNSI	RCATGY	1 cut(s)	251
BstSCI	CCNGG	1 cut(s)	228
BstZ17I	GTATAC	1 cut(s)	316
Cac8I	GCNNGC	1 cut(s)	249
Cfr13I	GGNCC	2 cut(s)	160, 221
Csp6I	GTAC	2 cut(s)	28, 294
CviAII	CATG	2 cut(s)	115, 248
CviJI	RGCY	5 cut(s)	41, 82, 109, 188, 212
CviKI_1	RGCY	5 cut(s)	41, 82, 109, 188, 212
CviQI	GTAC	2 cut(s)	28, 294
DdeI	CTNAG	1 cut(s)	42
DpnI	GATC	2 cut(s)	150, 173
DpnII	GATC	2 cut(s)	148, 171
Eco47I	GGWCC	2 cut(s)	160, 221
EcoRII	CCWGG	1 cut(s)	228
FaeI	CATG	2 cut(s)	118, 251
FaiI	YATR	6 cut(s)	12, 116, 198, 249, 316, 325
FalI	AAGNNNNNCTT	1 cut(s)	302
FatI	CATG	2 cut(s)	114, 247
FblI	GTMKAC	1 cut(s)	315
FspBI	CTAG	1 cut(s)	261
HapII	CCGG	1 cut(s)	163
Hin1II	CATG	2 cut(s)	118, 251
HinfI	GANTC	2 cut(s)	23, 233
HpaII	CCGG	1 cut(s)	163
Hpy166II	GTNNAC	1 cut(s)	316
Hpy188I	TCNGA	1 cut(s)	55
Hpy188III	TCNNGA	2 cut(s)	152, 163
Hpy8I	GTNNAC	1 cut(s)	316
HpyCH4III	ACNGT	2 cut(s)	179, 290
HpyF3I	CTNAG	1 cut(s)	42
Hsp92II	CATG	2 cut(s)	118, 251
Kpn2I	TCCGGA	1 cut(s)	162
Kzo9I	GATC	2 cut(s)	148, 171
LpnPI	CCDG	5 cut(s)	176, 215, 242, 257, 297
MaeI	CTAG	1 cut(s)	261
MalI	GATC	2 cut(s)	150, 173
MboI	GATC	2 cut(s)	148, 171
MboII	GAAGA	1 cut(s)	150
MnlI	CCTC	5 cut(s)	37, 93, 127, 151, 202
MroI	TCCGGA	1 cut(s)	162
MseI	TTAA	1 cut(s)	143
MspI	CCGG	1 cut(s)	163
MspR9I	CCNGG	1 cut(s)	230
MvaI	CCWGG	1 cut(s)	230
NdeII	GATC	2 cut(s)	148, 171
NlaIII	CATG	2 cut(s)	118, 251
NspI	RCATGY	1 cut(s)	251
PaeI	GCATGC	1 cut(s)	251
PfeI	GAWTC	2 cut(s)	23, 233
Pfl23II	CGTACG	1 cut(s)	27
Psp6I	CCWGG	1 cut(s)	228
PspGI	CCWGG	1 cut(s)	228
PspLI	CGTACG	1 cut(s)	27
PspPI	GGNCC	2 cut(s)	160, 221
RsaI	GTAC	2 cut(s)	29, 295
RsaNI	GTAC	2 cut(s)	28, 294
SaqAI	TTAA	1 cut(s)	143
Sau3AI	GATC	2 cut(s)	148, 171
Sau96I	GGNCC	2 cut(s)	160, 221
ScrFI	CCNGG	1 cut(s)	230
SetI	ASST	6 cut(s)	43, 84, 104, 162, 226, 315
SinI	GGWCC	2 cut(s)	160, 221
SmlI	CTYRAG	1 cut(s)	95
SmoI	CTYRAG	1 cut(s)	95
SphI	GCATGC	1 cut(s)	251
SspMI	CTAG	1 cut(s)	261
StyD4I	CCNGG	1 cut(s)	228
TaaI	ACNGT	2 cut(s)	179, 290
TaqI	TCGA	2 cut(s)	207, 214
TfiI	GAWTC	2 cut(s)	23, 233
Tru1I	TTAA	1 cut(s)	143
Tru9I	TTAA	1 cut(s)	143
TspDTI	ATGAA	2 cut(s)	77, 131
VpaK11BI	GGWCC	2 cut(s)	160, 221
XceI	RCATGY	1 cut(s)	251
XmiI	GTMKAC	1 cut(s)	315
XspI	CTAG	1 cut(s)	261

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.