RchiOBHm_Chr1g0322901

Homeobox-leucine zipper protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
10368309 .. 10373126
4818 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 216 bp
ATGGCTATGTCCTGCACGGATGATAAAAGAGTAATGGATAATGGCAAGTATGTGAGGTACAAACCTGAGCAGGTTGTTGAAGCCCTTGAGAGGCTTTATCATGACTGCTCCAAACCCAGTTCGATTCATCGCCAACAGCTCATTAAGGAGTACCCAATTCTCTCTAACATTGAGCCTAGCCAAATCAAAGTTTGGTTCCAGAACAGAAGCTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.42

Weight (kDa)

8.64

Isoelectric Point (pI)

72.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Homeodomain PF00046 18 - 69 3.2e-10 Homeodomain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 61
AfaI GTAC 2 cut(s) 59, 152
AfiI CCNNNNNNNGG 1 cut(s) 90
AgsI TTSAA 1 cut(s) 80
AluBI AGCT 2 cut(s) 139, 210
AluI AGCT 2 cut(s) 139, 210
BfaI CTAG 1 cut(s) 177
BfuAI ACCTGC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 197
BmrI ACTGGG 1 cut(s) 111
BmuI ACTGGG 1 cut(s) 111
Bpu10I CCTNAGC 1 cut(s) 66
BpuEI CTTGAG 1 cut(s) 107
Bsc4I CCNNNNNNNGG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 117
BseGI GGATG 1 cut(s) 25
BseLI CCNNNNNNNGG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 1 cut(s) 117
BslI CCNNNNNNNGG 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 58
BspHI TCATGA 2 cut(s) 100, 212
BspLI GGNNCC 1 cut(s) 197
BspMI ACCTGC 1 cut(s) 61
BsrI ACTGG 1 cut(s) 117
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 25
BtgZI GCGATG 1 cut(s) 113
BtsCI GGATG 1 cut(s) 25
BveI ACCTGC 1 cut(s) 61
CciI TCATGA 2 cut(s) 100, 212
Csp6I GTAC 2 cut(s) 58, 151
CviAII CATG 2 cut(s) 101, 213
CviJI RGCY 7 cut(s) 5, 83, 94, 139, 175, 180, 210
CviKI_1 RGCY 7 cut(s) 5, 83, 94, 139, 175, 180, 210
CviQI GTAC 2 cut(s) 58, 151
DdeI CTNAG 1 cut(s) 66
FaeI CATG 2 cut(s) 104, 216
FaiI YATR 4 cut(s) 8, 51, 102, 214
FatI CATG 2 cut(s) 100, 212
FokI GGATG 1 cut(s) 32
FspBI CTAG 1 cut(s) 177
Hin1II CATG 2 cut(s) 104, 216
HinfI GANTC 1 cut(s) 124
Hpy188III TCNNGA 3 cut(s) 101, 199, 213
HpyCH4V TGCA 1 cut(s) 15
HpyF3I CTNAG 1 cut(s) 66
Hsp92II CATG 2 cut(s) 104, 216
LmnI GCTCC 1 cut(s) 113
LpnPI CCDG 5 cut(s) 25, 56, 78, 130, 212
MaeI CTAG 1 cut(s) 177
MluCI AATT 1 cut(s) 156
MnlI CCTC 2 cut(s) 48, 84
MseI TTAA 1 cut(s) 144
NlaIII CATG 2 cut(s) 104, 216
NlaIV GGNNCC 1 cut(s) 197
PagI TCATGA 2 cut(s) 100, 212
PfeI GAWTC 1 cut(s) 124
PspN4I GGNNCC 1 cut(s) 197
RsaI GTAC 2 cut(s) 59, 152
RsaNI GTAC 2 cut(s) 58, 151
SaqAI TTAA 1 cut(s) 144
SetI ASST 5 cut(s) 59, 67, 75, 141, 212
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 1 cut(s) 156
SspMI CTAG 1 cut(s) 177
TaqI TCGA 1 cut(s) 122
TasI AATT 1 cut(s) 156
TfiI GAWTC 1 cut(s) 124
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TspDTI ATGAA 1 cut(s) 116
TspGWI ACGGA 1 cut(s) 32
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.