Rh5CG515000

Homeobox-leucine zipper protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0005555
Physical Location & Seq
Reverse (-)
71887026 .. 71891358
4333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG515000.1

Sequence Viewer

Length: 342 bp
ATGGCTATGTCCTGCACGGATGGTAAAGGAGTAATGGATAATGGCAAGTATGTGAGGTACAAACCTGAGCAGGTTGTTGAAGGCCTTGAGAGGCTTTATCATGAATGCTCCAAACCCAGTTTGATTCGTCGCCAACAGCTCATTAAGGAGTACCCAATTCTCTCTAACATTGAGCCTAGCCAAATCAAAGTTTGGTTCCAGAACAGAAGGTATTCTTGTTTCATAGATAATTGCCTTTTCTTCATCTATAGGCTTTGTACTTTATTTCATTTGTGGCTCAGAGAATCTAAGCGAAAGAAAAATGAATTTTTTGGTTTGGATCTTGAGTCTATGATTCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Homeobox MEKHLA START

Protein Analysis

113

Amino Acids

13.62

Weight (kDa)

9.02

Isoelectric Point (pI)

69.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Homeodomain PF00046 17 - 70 7.3e-11 Homeodomain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 61
AclWI GGATC 1 cut(s) 327
AcsI RAATTY 1 cut(s) 305
AfaI GTAC 3 cut(s) 59, 152, 259
AgsI TTSAA 1 cut(s) 80
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
AlwI GGATC 1 cut(s) 327
AoxI GGCC 1 cut(s) 82
ApoI RAATTY 1 cut(s) 305
Asp700I GAANNNNTTC 1 cut(s) 211
BccI CCATC 1 cut(s) 14
BfaI CTAG 1 cut(s) 177
BfmI CTRYAG 1 cut(s) 247
BfuAI ACCTGC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 197
BmrI ACTGGG 1 cut(s) 111
BmuI ACTGGG 1 cut(s) 111
Bpu10I CCTNAGC 1 cut(s) 66
BpuEI CTTGAG 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 117
BseGI GGATG 1 cut(s) 25
BseMII CTCAG 2 cut(s) 57, 292
BseNI ACTGG 1 cut(s) 117
BshFI GGCC 1 cut(s) 84
BsmI GAATGC 1 cut(s) 110
BsnI GGCC 1 cut(s) 84
Bsp143I GATC 1 cut(s) 319
BspANI GGCC 1 cut(s) 84
BspCNI CTCAG 2 cut(s) 58, 291
BspHI TCATGA 1 cut(s) 100
BspLI GGNNCC 1 cut(s) 197
BspMI ACCTGC 1 cut(s) 61
BspPI GGATC 1 cut(s) 327
BsrI ACTGG 1 cut(s) 117
BssMI GATC 1 cut(s) 319
BstDEI CTNAG 3 cut(s) 66, 278, 288
BstF5I GGATG 1 cut(s) 25
BstKTI GATC 1 cut(s) 322
BstMBI GATC 1 cut(s) 319
BstSFI CTRYAG 1 cut(s) 247
BstX2I RGATCY 1 cut(s) 319
BstYI RGATCY 1 cut(s) 319
BsuRI GGCC 1 cut(s) 84
BtsCI GGATG 1 cut(s) 25
BveI ACCTGC 1 cut(s) 61
CciI TCATGA 1 cut(s) 100
Csp6I GTAC 3 cut(s) 58, 151, 258
CviAII CATG 1 cut(s) 101
CviJI RGCY 8 cut(s) 5, 84, 94, 139, 175, 180, 253, 277
CviKI_1 RGCY 8 cut(s) 5, 84, 94, 139, 175, 180, 253, 277
CviQI GTAC 3 cut(s) 58, 151, 258
DdeI CTNAG 3 cut(s) 66, 278, 288
DpnI GATC 1 cut(s) 321
DpnII GATC 1 cut(s) 319
Eco147I AGGCCT 1 cut(s) 84
FaeI CATG 1 cut(s) 104
FaiI YATR 7 cut(s) 8, 51, 102, 224, 249, 332, 340
FalI AAGNNNNNCTT 2 cut(s) 199, 231
FatI CATG 1 cut(s) 100
FokI GGATG 1 cut(s) 32
FspBI CTAG 1 cut(s) 177
HaeIII GGCC 1 cut(s) 84
Hin1II CATG 1 cut(s) 104
HinfI GANTC 4 cut(s) 124, 284, 326, 334
Hpy188I TCNGA 1 cut(s) 281
Hpy188III TCNNGA 3 cut(s) 101, 199, 323
Hpy99I CGWCG 1 cut(s) 132
HpyAV CCTTC 2 cut(s) 74, 201
HpyCH4V TGCA 1 cut(s) 15
HpyF3I CTNAG 3 cut(s) 66, 278, 288
Hsp92II CATG 1 cut(s) 104
Kzo9I GATC 1 cut(s) 319
LmnI GCTCC 1 cut(s) 113
LpnPI CCDG 5 cut(s) 25, 56, 78, 130, 212
MaeI CTAG 1 cut(s) 177
MalI GATC 1 cut(s) 321
MboI GATC 1 cut(s) 319
MboII GAAGA 1 cut(s) 232
MflI RGATCY 1 cut(s) 319
MluCI AATT 3 cut(s) 156, 229, 305
MlyI GAGTC 1 cut(s) 335
MnlI CCTC 2 cut(s) 48, 84
MroXI GAANNNNTTC 1 cut(s) 211
MseI TTAA 1 cut(s) 144
Mva1269I GAATGC 1 cut(s) 110
NdeII GATC 1 cut(s) 319
NlaIII CATG 1 cut(s) 104
NlaIV GGNNCC 1 cut(s) 197
PagI TCATGA 1 cut(s) 100
PceI AGGCCT 1 cut(s) 84
PctI GAATGC 1 cut(s) 110
PdmI GAANNNNTTC 1 cut(s) 211
PfeI GAWTC 3 cut(s) 124, 284, 334
PleI GAGTC 1 cut(s) 334
PpsI GAGTC 1 cut(s) 334
PspN4I GGNNCC 1 cut(s) 197
PsuI RGATCY 1 cut(s) 319
RsaI GTAC 3 cut(s) 59, 152, 259
RsaNI GTAC 3 cut(s) 58, 151, 258
SaqAI TTAA 1 cut(s) 144
Sau3AI GATC 1 cut(s) 319
SchI GAGTC 1 cut(s) 335
SetI ASST 5 cut(s) 59, 67, 75, 141, 212
SfcI CTRYAG 1 cut(s) 247
SmlI CTYRAG 2 cut(s) 86, 323
SmoI CTYRAG 2 cut(s) 86, 323
Sse9I AATT 3 cut(s) 156, 229, 305
SseBI AGGCCT 1 cut(s) 84
SspMI CTAG 1 cut(s) 177
StuI AGGCCT 1 cut(s) 84
TasI AATT 3 cut(s) 156, 229, 305
TatI WGTACW 1 cut(s) 257
TfiI GAWTC 3 cut(s) 124, 284, 334
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TspDTI ATGAA 5 cut(s) 117, 211, 232, 257, 318
TspGWI ACGGA 1 cut(s) 32
XapI RAATTY 1 cut(s) 305
XmnI GAANNNNTTC 1 cut(s) 211
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.